Feed on Posts or Comments 30 June 2015

Christianity Thomas on 08 Mar 2013 01:27 am

The insanity of religion – God’s plan edition

Here we find a great example of the insanity of religion:

God’s existence addressed

Through reflection, study and reading the works of C.S. Lewis, Lee Strobel and others, Kraftson said he found solid answers to his questions early in his college career.

“Which brought up the question: What do I want to do with my life?” Kraftson said. “I graduated college in 1970, which some of you may recall was a pretty turbulent time in our country, but also a time when many were joining the Peace Corps and things like that.”

Having concluded that God exists and does have a plan for everyone, Kraftson decided to share that message through interacting with people.

“Having concluded that God exists and does have a plan for everyone…” Imagine the level of insanity it takes to look at our world and reach that conclusion. Think of the 10 million children per year who die of starvation, the millions more who die senselessly of cancer and heart attacks, the millions slaughtered in war, and the millions more who perish in natural disasters. God says, “yes, my plan for you is to grow to age three and then to be crushed when your apartment collapses in an earthquake.” Only insanity could see that as a plan.

481 Responses to “The insanity of religion – God’s plan edition”

  1. on 08 Mar 2013 at 10:57 am 1.Anonymous said …

    How can anyone believe Lee Strobel?

  2. on 08 Mar 2013 at 5:04 pm 2.DPK said …

    1.Anonymous said …

    “How can anyone believe Lee Strobel?”

    How can anyone believe everything happens according to god’s plan, but if you ask him nicely, he will change it for you?

    I’d add Strobel to a long list of “How can anyone believe…?” questions that I have.

    It’s not difficult, PT Barnum said one is born every minute.

  3. on 08 Mar 2013 at 8:54 pm 3.The messenger said …

    Thomas the Inain, 10 million childern are not dieing every day.

    why do you forge such appauling lies?

    who made thius estement?

    Where did you get this information?

    If you are unable to site your sources then that proves that you are not only inain, you are also metally unstable.

    I pray for you; you imature Child(aka thomas).

  4. on 08 Mar 2013 at 8:56 pm 4.The messenger said …

    Thomas the Inain, 10 million childern are not dying every day.

    Why do you forge such appaulling lies?

    Who made this estement?

    Where did you get this information?

    If you are unable to site your sources, then that proves that you are not only inain, you are also metally unstable.

    I pray for you; you immature Child(aka thomas).

  5. on 09 Mar 2013 at 1:52 pm 5.alex said …

    “10 million childern are not dying every day.”

    what is it then, you fucken troll? 985? 435,238? 1? or none? go argue with your mooslim bro, s0l. maybe he has some spare sheep.

    go pray for a brain, fuckhead.

  6. on 09 Mar 2013 at 2:06 pm 6.DPK said …

    Messenger, are you an habitual liar, or do you just have a reading comprehension problem? He did not say 10 million children die from hunger each day, he said each YEAR.
    The in estimates 25,000 people die from hunger and malnutrition every day. The majority of them are children. That’s 9.1 million per year… Close enough?
    Besides, whether its 1 thousand, 1 million, or10 million, the point remains… What’re is your god?
    Why don’t you answer the question instead of quibbling about how many children your supposed god allows to starve to death as part of his holy plan?

  7. on 09 Mar 2013 at 2:08 pm 7.DPK said …

    Sorry.. The UN estimates 25k die from hunger each day:

  8. on 09 Mar 2013 at 2:28 pm 8.s0l0m0n said …


    And billions….& billions…& countlesss…..huamans….and other beings….that god have sustain their food supplies for their livelihood…


    Why don’t you account for that fact DPK???

    Indeed you are the inhabitants of ((((((((HHHHHEEEELLLLL)))))!!!!!

  9. on 09 Mar 2013 at 2:29 pm 9.s0l0m0n said …


    …..huamans….should be ……humans….

  10. on 09 Mar 2013 at 4:33 pm 10.alex said …

    “god have sustain their food supplies for their livelihood…”

    not a fact, asshole, non gratis. go baaack to sheep. bullshit will get no pass here. fuck off, unless you got proof, allahu akbar.

  11. on 09 Mar 2013 at 6:24 pm 11.The messenger said …

    6 DPK, I miss read his writings, my apologies.

  12. on 09 Mar 2013 at 6:29 pm 12.The messenger said …

    There are more religious organization than Atheist organizations that work to help the starving people of the world.



  13. on 09 Mar 2013 at 6:30 pm 13.The messenger said …

    on 08 Mar 2013 at 8:46 pm 160.The messenger said …
    134.The messenger said …
    DPK, that statement that you quoted from my comment is useless in this argument because it has nothing to do with the debade conserning the issue of wheather or not God is more likly to answer a prayer with or without a saints involement.
    I stated the following sentence within the comment that you quoted from, thus proving that you are lying about me stating that prayers are more likely to be answered with the assistance of a saint.
    “praying to a saint is not required, God can answer your prayers either way.”
    If you are unable to understand the fact that you are wrong, I would sugjest that you check into a mental hospitle as soon as possible.

  14. on 09 Mar 2013 at 9:38 pm 14.alex said …

    “There are more religious organization than Atheist organizations that work to help the starving people of the world.”

    there are more foreskins snipped off by the dumbass religious fuckheads than do atheists, and????? diversions failed yet again. fuck off. your mooslim brother, s0l, has spare sheep.

  15. on 10 Mar 2013 at 12:06 am 15.Curmudgeon said …


    I did not think it possible. All the letters you typed into this thread and neither of you said anything consequential.

    Kudos! Well done sirs!

  16. on 10 Mar 2013 at 12:36 am 16.The messenger said …

    Brother 14.alex, why do you keep bringing foreskin randomly into these arguements?

    Stop obsessing over foreskins you idiot.

  17. on 10 Mar 2013 at 12:45 am 17.Anonymous said …

    So, many attempts to change the subject, but not one theist has the courage to even attempt to try to explain why a supposedly loving god has a “plan” that involves inflicting intense and cruel suffering on innocent children.

    That fact alone speaks volumes for the fear the religious have about contrasting the real world with the one they think their story book tells them exists.

    It’s pretty sad how desperate Crum and his cronies are that they won’t even try to think for themselves.

  18. on 10 Mar 2013 at 12:57 am 18.gfunk said …

    If god did exists nobody would ever die. Just anuther reason why we know their is no God.

  19. on 10 Mar 2013 at 1:10 am 19.alex said …

    blah, kjaksjdf, shit, whtf. see? it doesn’t really matter what i say or who i am. your god is bullshit. your diversions won’t work. i’m hip to your shit and so is everybody here.

    the foreskins and the smell of burnt flesh is in your bullshit bible. the question is, why is your bullshit god so obsessed with them?

    messenger, go fuck yourself. or like your mooslim brother says, gaze at the sun and you’ll see the bullshit hell.

    you can point a thousand, million things about atheists and it doesn’t change a damn thing. your god is bullshit. capiche?

  20. on 10 Mar 2013 at 1:29 am 20.alex said …

    “All the letters you typed into this thread and neither of you said anything consequential.”

    says the theist dumbfuck, who patrols the atheist site and spews lame bullshit diversions. when called out, the same dumbfuck ducks and reappears over and over again and again as the same, lame shithead.

    atheists put up with your shit everywhere and now is the time for you fuckers to shut the fuck up. go ahead, put me out of business. say something bright.

  21. on 10 Mar 2013 at 3:11 am 21.Hell Yeah said …

    “praying to a saint is not required, God can answer your prayers either way. If you are unable to understand the fact that you are wrong, I would sugjest that you check into a mental hospitle as soon as possible.”

    God answers prayers? First of all, no gods are real. None of the 100’s of them made up by mankind overtime, including yours. Also, your god if you think he exists and answers prayers, then why are the prayers answered randomly as if there was no god answering them? Just take out the middleman, which is your god. For example, athletes giving credit to god for them winning. Ray Lewis gave credit to god for giving him this latest super bowl win. Isn’t this the same guy who has a troubled past with the law such as potentially being part of a murder? So what you are saying is that your god gave him the super bowl as a reward to his crimes, but others who pray just to live another day don’t get theirs answered? How is that any different than there being no god answering any prayers and things just happen at random?

    Believing in the supernatural should be a reason to check into a mental hospital. Afterall, you are talking to imaginary friends.

  22. on 10 Mar 2013 at 3:44 am 22.s0l0m0n said …


    You can fit those foreskin into your f****n head and then shut the F**k up.

  23. on 10 Mar 2013 at 4:34 am 23.DPK said …

    “134.The messenger said …
    DPK, that statement that you quoted from my comment is useless in this argument ..”

    William, your being caught in this lie really seems to have struck a nerve with you. So much so that you brought it over from another thread and you keep bringing it up. It must really bother you.
    Sadly, you cannot take back what is written in black and white. You first said one thing, and then tried to take it back when caught. Why don’t you just admit you were talking out of your ass and say you’re sorry. You do it frequently enough that no one will think any less of you. Here’s a clue though, you don’t need to apologize to me, because I think BOTH of your explanations are pure bullshit. There are no saints in heaven who are “close to god” and who get help get your prayers answered because there are no saints, there is no heaven, and there is no god answering prayers. That is why your god ignores the prayers of those MILLIONS of starving children, but he help professional football players score touchdowns and helps Crum find his car keys when he’s lost them again.
    It is also why you cannot present any actual evidence that your imaginary god exists, because, just like every other god throughout the entirety of human history, this one is just as make-believe. Grow up.

  24. on 10 Mar 2013 at 8:58 am 24.Xcanthean Zeno said …

    “god is all loving, all knowing, all powerful,ect

    Real life
    “God is sadistic, powerless, knows nothing,ect

    Any theists wanna try to explain this one?

  25. on 10 Mar 2013 at 3:19 pm 25.The messenger said …

    23.DPK, stop the madness.

    I proved to you that I am not lying. I provided evidence that supports my claim of innocence.

    The evidence that I have provided is located within comment 13.

    Why do you continue to ignore this evidence, and continue to lie about it?

  26. on 10 Mar 2013 at 4:56 pm 26.The messenger said …

    on 09 Mar 2013 at 6:29 pm 12.The messenger said …
    There are more religious organization than Atheist organizations that work to help the starving people of the world.

  27. on 10 Mar 2013 at 5:59 pm 27.alex said …

    “There are more religious organization than Atheist organizations that work to help the starving people of the world.”

    what, more random shit? bible foreskins, asshole.

  28. on 10 Mar 2013 at 6:08 pm 28.The messenger said …

    27.alex, I presented a argument against Thomas’s post.

    Stop obsessing over foreskin.

  29. on 10 Mar 2013 at 6:28 pm 29.DPK said …

    25.The messenger said …

    23.DPK, stop the madness….

    Sure William.. I’m over it. You’re the one who won’t let it go. Maybe you should pray to a sint to help you out there.

    “There are more religious organization than Atheist organizations that work to help the starving people of the world.”

    Well, that stands to reason because there are more religious people in the world than there are atheists. In fact, we are so out numbered, I wonder why there are still starving people in the world?
    Maybe you should pray to St. Whoever the fuck and ask him to ask god to help out. It would be simple for him, being all powerful and all…. but since you already explained that EVERYTHING happens according to god’s plan, why cant you realize that god obviously WANTS those children to starve to death. Seem that the atheists help feed them because its the right thing to do, but the religious people help feed them because they thing god’s plan is a bad idea and want it to stop.

    Answer this question William… if you can do it without lying. If god made things so that some 9 million people die of starvation every day, why do you pray to god to change his mind? Should you not accept starvation as part of god’s plan?

  30. on 10 Mar 2013 at 6:46 pm 30.Curmudgeon said …


    Atheist have an out….no moral absolutes. So why should they help anyone?

    Christians send money and people in huge numbers. Atheists sit and whine and complain. Surveys have shown what tightwads they are.


    Against great reasoning power!

  31. on 10 Mar 2013 at 7:29 pm 31.DPK said …

    29.Curmudgeon said …
    “Atheist have an out….no moral absolutes.”

    And yet… they do it anyway. Why is that Curm?
    You actually have NO IDEA how much I give to charity and how much time and effort I volunteer to help in my community for a number of good causes. Your bigotry and hatefulness is so transparent, and very unbecoming not to mention downright insulting. You are right, I have no moral absolutes, and neither do you,,, because there is no such thing. You have had your asshole reamed on that issue so many times, you must have a really hard time walking. If you are going to claim christians have a moral absolute, show us where it is and what it says. You won’t, because you are a LIAR.
    Lemme guess, you probably think black folks are all lazy and on welfare, huh?

    “Christians send money and people in huge numbers…” Fighting the will of god at every turn. Why do they do that Curm? Explain to us why they don’t bend to god’s will. I mean, 9.1 million people…. that’s not an insignificant number… god must be very adamant about wanting a good portion of the population to die a horrible death of malnutrition and starvation. I gather you think that is a wrong that needs to be corrected? Why don’t you just pray it away? God answers prayers all the time, right? That sure seems like it would be a good one for him to answer. Why won’t he do that?

  32. on 10 Mar 2013 at 8:25 pm 32.The messenger said …

    Brother 30.Curmudgeo, I agree.

  33. on 10 Mar 2013 at 9:29 pm 33.Lou said …

    About a year ago there was one these very rare atheist charities begging atheist to give. Surveys have shown atheist and liberals in general are not very charitable with the cash.

  34. on 10 Mar 2013 at 9:36 pm 34.The messenger said …

    29.DPK, Suffering is a part of GOD’S plan.

    God’s plan is for suffering to occur, and for humans to be kind to one anouther and to help others overcome suffering.

  35. on 10 Mar 2013 at 10:42 pm 35.DPK said …

    The Catholic church has paid out 2.2 BILLION dollars to sexual abuse victims in the US alone….
    And.. they spend a paltry 2.7% of their estimated $170 BILLION dollar annual spending on charity.
    Not even to mention the hundreds of billions in assets it has squirreled away.

    And if you give to one of those Bible Belt mega-churches… how much of your money do you think is going to feed hungry kids, and how much is spent on giant church-stadiums, private jets and mansions for preachers and directors?

    And even if every atheist in the world was a tight fisted scrooge… how does that in any way demonstrate that your imaginary god is real?
    You guys never give up with trying to throw red herrings into the blender to try and cover up the fact that what you are mixing in there is 100% BULLSHIT.

    Next diversion?

  36. on 11 Mar 2013 at 12:01 am 36.Anonymous said …

    Lou, what do you think of a god who allows, even plans for, 10 million children a year to die of starvation? Why would anyone worship such a monster?

  37. on 11 Mar 2013 at 12:45 am 37.alex said …

    “…a god who allows, even plans for, 10 million children a year to die..”

    the bullshit god is too busy ignoring saints that bullshit xtians pray to. the bullshit god is too busy granting touchdowns and at the same time, meticulously planning the path of the bullshit bullet so that it barely misses the brain stem, therefore allowing the little girl to live. the bullshit god is too busy planning s0l’s height so that he can hump the sheep while standing comfortably.

    hey, i’m not a hater. just won’t put up with bs. and for messenger, a random, biblical foreskin! put it on your grill. remember, the odor of burning flesh is pleasing to the lord. bleh!

  38. on 11 Mar 2013 at 1:32 am 38.DPK said …

    34.The messenger said …
    29.DPK, Suffering is a part of GOD’S plan.

    I know… so why do you fight AGAINST god’s plan? You should be thanking god for starving children William. You so silly!
    Why did god make cancer? I mean that’s part of god’s plan too. Why would you get medical treatment for cancer if god gave it to you? That’s bold man… trying to use science to rid yourself of a disease that god wants you to have. That’s just wrong.

  39. on 11 Mar 2013 at 2:03 am 39.Lou said …


    Prove God plans for these children to die. Atheists what are YOU doing about these children since God is um, er, arh, imaginary? Apparently YOU don’t care even as much as this supposed imaginary being?

    Why do we even speak to such monsters.

  40. on 11 Mar 2013 at 2:16 am 40.The messenger said …

    Brother 38.DPK, because in the end, all of the suffering will end and everyone will go to heaven.

  41. on 11 Mar 2013 at 2:19 am 41.The messenger said …

    Brother 37.alex, If you want the suffering to end, follow God and help the suffering people of the world. True Christians are always trying to help others. Do the same.

  42. on 11 Mar 2013 at 2:21 am 42.The messenger said …

    Brother 35.DPK, those people who were accused of sexual abuse are not true Catholics.

    A true Catholic would never do that.

  43. on 11 Mar 2013 at 2:30 am 43.alex said …

    “Prove God plans for these children to die.”

    when your bullshit god doesn’t come thru in the clutch, you morons go into spin, apologist, overdrive. wah! my child/mother/lover/etc is in a better place, because it’s god’s will. the irony is lost/wasted on you morons. wah? and a better place?

    look in the mirror, moron. there’s your proof. you’ve swallowed it, god, bible, hook, and all.

    remember, to stop all this atheist nonsense, bring on the proof. btw, the bible/kohrain/holyShit is not.

  44. on 11 Mar 2013 at 2:33 am 44.alex said …

    “Apparently YOU don’t care even as much as this supposed imaginary being?”

    retarded. i don’t care as much as santa? gtfooh.

  45. on 11 Mar 2013 at 2:44 am 45.The messenger said …

    44.alex, are you on drugs?

  46. on 11 Mar 2013 at 2:44 am 46.The messenger said …

    on 11 Mar 2013 at 2:44 am 45.The messenger said … Your comment is awaiting moderation.
    44.alex, are you on drugs?

  47. on 11 Mar 2013 at 3:06 am 47.DPK said …

    Once again Lou, you pompos asshole… You have NO IDEA what I, or any other atheist, does or don’t do. If you did, you would seem a bigger fool than you are. What I don’t do is molest children, or conspire to protect those who do. What I don’t do is fleece old ladies out of their savings or social security checks to finance a lavish lifestyle or build an opulent church so I can fleece more people.
    And even if I was a completely heartless monster who told his little victims that Jesus will cry if you tell about me putting my holy dick in your mouth…. What has that got to do with the reality of your imaginary god.
    Lots of parents shower their children with love and gifts at Christmas. Does that make Santa Claus real? Of course not. You are either an idiot, or a desperate paranoid lunatic. Grasp at straws much there, Lou?

  48. on 11 Mar 2013 at 2:22 pm 48.Lou said …

    That’s great news DPK.

    Maybe you can prove God plans for these children to die as anony claims. What are atheists doing about these starving children since God is um, er, arh, imaginary? Anything?

    The Christians are doing a lot, you know, the monsters and you are doing little. That makes you worse than a monster.

    And the word is pompous. If you desire to use a big word at least know how it is spelled.

  49. on 11 Mar 2013 at 2:44 pm 49.Anonymous said …

    more diversions. Suh has been replaced by Lou. Same tactic, same school of grammar, different name.

    Lou, the question was what do you think of a god who plans or allows children to starve? That’s the question for you to answer.

  50. on 11 Mar 2013 at 3:50 pm 50.s0l0m0n said …

    alex will be dumped into the bottom most and hottest of ((((HELL))))

  51. on 11 Mar 2013 at 3:52 pm 51.Lou said …


    Good, back from running!

    Maybe you will now prove God plans for these children to die as you claim. From there, we can address your new diversion.

    Then again, seeing that you will not, maybe all your claims are just diversions?

  52. on 11 Mar 2013 at 4:13 pm 52.DPK said …

    “Maybe you can prove God plans for these children to die as anony claims.”

    That’s not my claim LOUser… remember, I think he is imaginary. It’s Christianity’s claim. Ask your buddy messenger.. everything happens according to his plan. If he is real an omnipotent, as you claim, he either planned it or allowed it.
    Yeah, the Christians are doing a lot… look at the Catholics, they spend an enormous 2.7 cents of every dollar they rake in for charity. Where does the other 97 cents go, Lou? To finance hush money for abuse vidtims, pay for papal Gucci loafers and helicoptor rides? Maybe to redecorate the Papal Apartment or to lawyers to protect church assets?

    Or maybe you belong to one of those “god hates fags” churchs who fly people around to picket the funerals of dead soldiers… or maybe you give to one of the big box churches that preach the bible of prosperity? Yeah, they throw some crumbs at 3rd world nations from the window of the Bently, huh?
    I said before, you have NO idea what I, or any other person does or does not do…. and who are you to judge anyway?
    You know who helps out the impoverished the MOST in the middle east? Al-Qaeda.
    Does that prove Allah is real? Sure it does, right.

    Want to know what kinds of things secular charities do in the world? Ever heard of Doctors Without Borders? UNICEF? Amnesty International? Goodwill? Rotary? S.H.A.R.E.?

    The simple fact is, yes, faith based groups do a lot of good in the world. So what? The fact that an individual who does not believe in a god does or does not give to a charity has no more bearing on the existence of said god than the fact that a priest who does believe in god ass rapes a 6 year old child.

    You would be better served to stop correcting typos and proved the evidence for your make believe god that you seem unable to produce. Enough with the red herrings. Nobody is buying it.

  53. on 11 Mar 2013 at 7:17 pm 53.Lou said …

    “That’s not my claim LOUser… remember, I think he is imaginary.”

    Oh, so Anony thinks God is real? I thought you were both atheists? Lets see if he can support his claim. It will be interesting.

    “The simple fact is, yes, faith based groups do a lot of good in the world. So what?”

    I know, too bad atheists do so little. Rather than spending all their money on billboards, Christmas, signs with God and fighting Christians who are doing good work, they could feed some hungry children.

  54. on 11 Mar 2013 at 7:24 pm 54.Lou said …

    “Ever heard of Doctors Without Borders? UNICEF? Amnesty International? Goodwill? Rotary? S.H.A.R.E.?”

    Yes, very much so. I have worked with (3) of them. My daughter just finished a project with Rotary International and they certainly are not atheists. Goodwill, UNICEF and DWB are a majority Christians and the majority of support comes from Christians. You can add the Red Cross to that list.

    So where are the atheists?

  55. on 11 Mar 2013 at 8:52 pm 55.DPK said …

    No, you idiot… those are secular organizations. They may have christians in them duh… because in this country most people are christians. But they are not “christian” organizations. They are not in the business of judging people, like you, and being bigoted and ignorant, like you.
    Do you have a point?
    Are you saying that because there isn’t an “Atheist Red Cross” that demonstrates that your make believe god is real? Your critical thinking skills need some serious help.
    Guess what? There is no “People who don’t believe in Gnomes Red Cross” either. But I’d say the overwhelming majority of people in the world don’t believe in gnomes. People who don’t believe in gnomes don’t give shit to charity Lou! How come you don’t see any “A-Gnomist… feeding the world” groups? You stupid twit. Would it be fair to say then that since the majority of people don’t believe in gnomes than the majority of people don’t support starving children? Your level of stupidity is absolutely astounding.

    Where are the atheists? They are everywhere. They are in your community, your government, your schools, and yes Lou… even in your church. You do know that a lot of people are “religious” simply as a social norm, right? Where they aren’t is with their hand in your pocket, asking for your money so they can help “spread the word.” But don’t worry, they most likely only laugh at you behind your back. You can always come here though, and we will laugh at you to your face.

  56. on 11 Mar 2013 at 10:02 pm 56.Lou said …

    “Do you have a point?”

    Yes, do you? Where are the atheist who are outraged over starving children? Why aren’t they feeding the children. You brought up the organizations AS IF they were atheist.

    “They are in your community, your government, your schools, and yes Lou… even in your church.”

    NOOOOOOOO, too scary.

    You are done just diversions and childlike wonder. Let’s see if anony will back up his claim that God plans for these children to die. You can join me in the anticipation.

  57. on 11 Mar 2013 at 10:09 pm 57.alex said …

    “Maybe you can prove God plans for these children to die as anony claims.”

    let’s say god didn’t. if your bullshit god doesn’t answer every prayer, then why not? you don’t know? but you sure as hell know when your god does, don’t you? when children die even when somebody prays for them why do you think that is? your god allowed it. what’s the proof? your own, declared, bullshit answered prayer, that god saved somebody because of prayer. if prayer is bullshit, then i’m wrong about your god allowing the deaths. but if prayer is bs…

    when your bullshit god allows the winning td, it disallows the other team to win. no? then giving thanks for the touchdown has to be bullshit. no?

  58. on 11 Mar 2013 at 10:35 pm 58.Anonymous said …

    Lou is a troll. Ignore him.

  59. on 11 Mar 2013 at 10:35 pm 59.The messenger said …

    55.DPK, there are many people who claim to be Atheists just to be socially normal in their society.

  60. on 11 Mar 2013 at 10:39 pm 60.alex said …

    its for my family that reads this blog….hi, familia!

  61. on 11 Mar 2013 at 10:41 pm 61.The messenger said …

    Mr. 57.alex, yes, some people do die in painful ways, but they will go to heaven afterwards if they have been kind and compassionate durring their life on Earth,

    Heaven is eternal paridice. So life heaven will be so great that those people will forget about their time in hell and they will live in happiness for all time.

  62. on 11 Mar 2013 at 10:45 pm 62.The messenger said …

    Mr. 55.DPK, you are wrong.

    They do not use the money to spead God’s word, they use it to help the poor and to repaire the Church when it is damaged.

  63. on 11 Mar 2013 at 11:21 pm 63.MrQ said …


    God plans for these children to die.

    Isn’t it ALL part of your god (the jewish zombie) plan? Does your god grant and take life at will? Does your god know all, see all, and is all powerful?
    Lou, truly you’re a first class idiot with low class ideas.

  64. on 12 Mar 2013 at 1:29 am 64.Lou said …

    I knew anony would have to respond and would not back up his own claims. My work exposing anony as a fraud is done.


    Son! What are you talking about? What is with TD and ballgames suddenly? You seem fond of feces. That seems appropriate coming from you cowboy.

  65. on 12 Mar 2013 at 1:47 am 65.alex said …

    bullshit = god = heaven = ufos = santa. refute it daddyo, mofo. you ask for clarity and you don’t like? move the goalpost is yo motto, trollo.

  66. on 12 Mar 2013 at 2:13 am 66.The messenger said …

    Idiot + alcohol + meth = alex.

  67. on 12 Mar 2013 at 2:15 am 67.The messenger said …

    Pot + crack + mental problems= DPK.

  68. on 12 Mar 2013 at 4:04 am 68.Anonymous said …

    Poor Lou, we’ve busted his sock puppet act so many times all he has left is to crap on the chessboard. What you don’t understand is that we see a sick and twisted individual lashing out at those around him. You think you are scoring points, but all you are doing is embarrassing yourself.

    Now, when you are ready to join in honest conversation, let us know. Until then, Lou has lost any right to ask questions or join in with the grownups.

  69. on 12 Mar 2013 at 4:20 am 69.DPK said …

    Once again , messenger and Lou/horatiio demonstrate the hyporacy of Christians by spewing their hate filled lies.

    on 12 Mar 2013 at 2:13 am 66.The messenger said …
    Idiot + alcohol + meth = alex.
    on 12 Mar 2013 at 2:15 am 67.The messenger said …
    Pot + crack + mental problems= DPK.

    James 4:11-12 ESV

    Do not speak evil against one another, brothers. The one who speaks against a brother or judges his brother, speaks evil against the law and judges the law. But if you judge the law, you are not a doer of the law but a judge. There is only one lawgiver and judge, he who is able to save and to destroy. But who are you to judge your neighbor?

  70. on 12 Mar 2013 at 4:38 am 70.Hell Yeah said …

    When are you guys going to realize that calling each other names because you are upset what the other side said isn’t proving any points. Reading through the comments it seems half of them are childish rants. For you religious folks, your god (which ever one of the hundreds in history you choose) is watching to see who is naughty or nice (or is that Santa?, who knows, they are all make believe).

    Religous people may seem like they give more to charity because they think their god is going to reward them in the afterlife because of it, that is all. It is all subconscience, that they don’t even realize it.

  71. on 12 Mar 2013 at 4:41 am 71.Hell Yeah said …

    Here is a comedy cartoon worth watching (the whole series is worth watching actually). But this is relavent to some of the discussion about God’s priorities.


  72. on 12 Mar 2013 at 7:44 am 72.Xcanthean Zeno said …

    Mind washing+Lack of will power+Ignorance+Selfishness of wanting to live forever= Christians…

    Any one please comment on this?

  73. on 12 Mar 2013 at 8:04 am 73.The messenger said …

    Brother 69.DPK, I do not hate you or Alex.

    I was just tired of having to deal with Alex’s constant pointless insulting comments.

    I allowed my anger get the better of me, and I am truly sorry.

    I ask for you and Alex’s forgiveness.

  74. on 12 Mar 2013 at 8:36 am 74.s0l0m0n said …


    Nobody could mocked him….


  75. on 12 Mar 2013 at 8:37 am 75.The messenger said …

    Brother 70.Xcanthean Zeno, my Grand father is a Christian and a soldier in the U.S. army. He was tuffer and braver than anyone I know, and he has more will power that you or any other Athiest ever will.

    His wife was dying of brain cancer, but he kept his faith in Jesus and he kept his family together, and he was still able to raise his five kids all by himself because he had faith in God and he had will power.

  76. on 12 Mar 2013 at 8:45 am 76.The messenger said …

    on 12 Mar 2013 at 8:04 am 71.The messenger said … Your comment is awaiting moderation.
    Brother 69.DPK, I do not hate you or Alex.
    I was just tired of having to deal with Alex’s constant pointless insulting comments.
    I allowed my anger get the better of me, and I am truly sorry.
    I ask for you and Alex’s forgiveness.

  77. on 12 Mar 2013 at 8:49 am 77.The messenger said …

    Brother DPK, the fact that you used (James 4:11-12 ESV) to show me that I was wrong for loosing my temper, is conclusive proof that The Bible is a very good source of moral guidance.

  78. on 12 Mar 2013 at 10:42 am 78.Xcanthean Zeno said …

    75.The messenger said …

    Brother 70.Xcanthean Zeno, my Grand father is a Christian and a soldier in the U.S. army. He was tuffer and braver than anyone I know, and he has more will power that you or any other Athiest ever will.

    His wife was dying of brain cancer, but he kept his faith in Jesus and he kept his family together, and he was still able to raise his five kids all by himself because he had faith in God and he had will power.

    Number one: By believing in such a impossible deity, he lacks will power.
    Number two: As a christian, he is betraying his god by fighting others and doing man slaughter, ohh wait…christians are meant to do that…
    Number 3: WTF has cancer got to do with anything? the fact that she had cancer and yet he kept his belief means nothing, if my mother had cancer (which she mildly does) i would not go “ohh shit, i must pray for her to stay healthy”no, i would go “well…lets hope good stuff happens to her”
    Number 4: having will power does not equate to believing in God

  79. on 12 Mar 2013 at 10:43 am 79.Xcanthean Zeno said …

    also, you need to read a dictionary, you have so many spelling mistakes…

  80. on 12 Mar 2013 at 11:33 am 80.Paula said …

    Goodness me. I’m horrified! Fighting over who’s right or wrong, belittling one another , judging each religion and announcing it with pride is clearly messed up. Can’t you see you are all so determined that your belief is right that you have become consumed with hate and anger? Which I believe makes you all completely wrong. It’s because of this sort of hypocracy I turned away from all self righteous religions and non believers – I’m not convinced any of you deserve that honor. God is love – his message is one of peace, compassion,forgiveness, generousity humility and a honesty. God isn’t hurtful or nasty – even I can work out that if we all truely practised love – we would all stop fighting – there wouldn’t be world hunger, poverty, wars, terrorist attacks and so on.. Seriously people – you don’t even need to believe in god to practise love.
    I can only hope and pray that you all see the light and unite as one – Then finally the world can all witness the true power of God Almighty! An unstopable army of love destroying evil – Can’t you hear in yr hearts that is what he is wants? I hear it – I’m sure others do too. Don’t let pride, ego, greed and fear stand in the way – forgive each other and on with it – isn’t that a no brainer ??
    Prove his existence once and for all.
    Yours sincerely,
    Practice what you preach

  81. on 12 Mar 2013 at 1:41 pm 81.Anonymous said …

    Messenger has already made up improbable stories about his medical situation all leading to miraculous interventions. He makes stuff up as he goes along, hence like the boy who calls wolf, this story ought to be taken with several large grains of salt.

  82. on 12 Mar 2013 at 2:35 pm 82.DPK said …

    William, you have said here now that I smoke crack and pot and have mental problems. None of which are true.
    Not only have you showed your anger and hatred toward me because I don not share your beliefs about your make believe god, you have done it by telling lies.

    Why should anyone believe anything you say? You preach love, but show hate, you claim truth, but speak lies.
    You claim to be a Catholic, but you deny the most basic principals of the Catholic faith.
    You are a fraud. Simple as that. You have no credibility. Zero.

  83. on 12 Mar 2013 at 6:39 pm 83.Asher said …

    “well…lets hope good stuff happens to her”

    Which accomplishes nothing.


    A good word but unfortunately you are expecting pagans to live like Christ which is impossible. It goes against all of the teachings of Christ. If pagans could do what you would like to see, Christ would never had needed to come in the first place. If the world was not fallen and cursed Jesus would not have had to come. You are looking for the new kingdom but it has yet to come.

  84. on 12 Mar 2013 at 7:56 pm 84.The messenger said …

    Brother 78.Xcanthean Zeno, it is easy to forget about Jesus and loose faith in him.

    A person with strong will power would keep his faith in God and would not resort to Atheism or anti theism.

  85. on 12 Mar 2013 at 8:02 pm 85.The messenger said …

    Brother 82.DPK, I was wrong for insulting you.

    I let my anger get the better of me, I humbly apologize.

    You should listen to what I preach because I am the bigger man in this confict, because I apologized for my insult; but you still have yet to apologize for the many hateful insults that you have stated about me.

  86. on 12 Mar 2013 at 9:20 pm 86.alex said …

    “A good word but unfortunately you are expecting pagans to live like Christ which is impossible. ”

    does anybody in here, give a fuck about pagans? go away with that shit and come back when you got something, you righteous, asshole, talking shit.

    “Fighting over who’s right or wrong…”

    you’re confused. nobody’s fighting, it’s just bullshit repelling. when i says bullshit, shut me up by proving me wrong. hey, i thought the earth was flat until somebody corrected me.

  87. on 12 Mar 2013 at 9:28 pm 87.The messenger said …

    Sister 80.Paula, I see that you contain great wisdom.

    I respect you, but I am not prideful. I see so much sin coming from Athiesm everyday that I know we must stand against it and Proventil it from tainting humanity further.

  88. on 12 Mar 2013 at 9:37 pm 88.alex said …

    Nobody could mocked him….”

    yeah, but you feel free to praise/thank him for your sheep? damn desert dweller. ka, ka, shit. and righteous enough to defend him?

  89. on 12 Mar 2013 at 9:48 pm 89.The messenger said …

    Mr. 88.alex, I honestly do no think that anyone on this site (including you) understood your comment.

  90. on 13 Mar 2013 at 2:31 am 90.DPK said …

    “Seriously people – you don’t even need to believe in god to practise love.”

    Well, finally, a theist that has said something true.

    “unfortunately you are expecting pagans to live like Christ which is impossible.”

    Asher, you have absolutely no idea how I live my life, now do you? But you assume I am evil because I don’t share your delusion.
    Can you honestly not see how bigoted and hateful you are?
    You judge me, and you have no idea. None.
    Pagans? Yeah, I haven’t heard that term used by anyone since I was in third grade and we used to collect dimes and quarters to “save the pagan babies” in Africa or somewhere. Presumably from a life of cannibalism and dark magic.
    Instead of coming on here with your bullshit diversions, why don’t you just go pray for us “pagans”? Wouldn’t that do a whole lot more good? Yeah, try that.

  91. on 13 Mar 2013 at 2:50 am 91.Paula said …

    Hi y’all,
    Thanks for commenting. All of us are entitled to our opinion, after all Gid ha e us free will. I’ve never read the bible nor follow religion as I stated earlier. I simply made a decision to put my faith in all that is good and practise it. I don’t intentionally hurt anyone, slander or judge and lead a honest life. Not based on God bit because in my heart if hearts I know it’s right. I’ve recently been in the position to help out family members financially to help as most are in minimum wage and struggle everyday. I gave without asking as I believed it was right. Since then all have slandered my name, judged without knowledge and turned their backs on me. All of whom lead unholy or what others would perceive as immoral lives. Boy, did that hurt. I questioned myself – why? Don’t they know who I am? What causes them to hate someone who has never given them reason? I felt alone – misunderstood and unloved. Two days after this happened, I here a knock in my door. Two well dress ladies in their late 50s introduced themselves from Jehovah Witness and handed me a booklet with a picture if Jesus on the front said good bye and left. I took it on hand, looked at the front page and threw it in the bin. I wasn’t until yesterday after speaking to a friend in the phone, it dawned in me – I was just reminded that all is not lost – Jesus appeared – ok not in the conventional manor – but never the less – he appeared. My take on it is – Jesus wanted me to know that he is with me and lot to loss faith. It was then I stumbled across this blog and felt I needed to say something. Now, I am not one to preach anything – I me we have – goodness I haven’t even read the bible. So what gives me the right? All I know is if everyone who follows any God or believes in love should realise that God is love – if we feel love and feel loved – then hasn’t God appeared to us already? Maybe, just maybe, we would all have the proof we need and stop doubting if he exists – blaming him for the state the world is in and get together to try and fix it. I have no idea how many people follow religion – but I’m guessing is a huge majority if the worlds population all did something together united as one to solve the worlds problems – I believe they would. Huge ask I know – it may mean that you may need to part with your wealth, give your time, help someone whom you feel is lower than you or humble yourself. I struggle to think that the wealthy churches and people of this world, along with anyone else are prepared to do that. Cause if they did, wouldn’t they have done it already? It’s “sin” that prevents them – fear of Lose, pride, ego, greed etc. That is why the world is in such a mess!! Most churches (not all) don’t even know that effectively they are preaching sin by their inability to truely give themselves over to God:Love.. Ha ha! Funny right? God must think we are the biggest pack of idiots – he must be thinking “why aren’t they listening to me?!!Why are they preaching sin and promoting evil in my name?!! Know wonder according to the bible (thanks google) he gets pretty mad in the end and destroys us all in the worst possible way. ***end of rant***

  92. on 13 Mar 2013 at 3:14 am 92.Paula said …

    Sorry about my terrible grammar – I sometimes am typing to fast to see I have made a spelling mistake and my iPhone predicts something totally different… I’ll proof read in the future.

  93. on 13 Mar 2013 at 9:08 am 93.Anonymous said …

    Paula, for someone claiming not to follow religion, you sure use a lot of Christian-specific words and phrases. Who is kidding who here?

    Still, if we accept your claim at face value, which god are you referring to and how do you know this one is real? Are the others false, and how do you know that?

    Also, what do you even need a good for in your essay? You seem to be saying help each other and be nice. This requires a supernatural being how?

    Finally. What prompted you to post and what is the connection with the subject of the blog post?

  94. on 13 Mar 2013 at 1:13 pm 94.Curmudgeon said …


    Thank you for sharing in a loving way. Isn’t funny how atheist who say they know more Bible than Christians but criticize those who use the words of the Bible like love, sin and God.

    I apologize in advance for those here eh use such offensive language and attack theists in such vile manner. Beware of trolls who use names like anonymous.

  95. on 13 Mar 2013 at 3:12 pm 95.DPK said …

    “I’ve never read the bible nor follow religion..”
    That’s obvious.. I HAVE read the bible. It’s hard to make a statement like “God is Love” after actually reading the bible. So, I take it your conclusion is the god of the bible is not the “real” god?

    “I simply made a decision to put my faith in all that is good and practise it…”

    Hood for you. I do the same. Why does that require faith in a magical being to do that? In fact, according the the theists here, you cannot know what is good without having read the bible,,because that is the source of absolute morality… and of course, the proper way to offer blood sacrifices and burnt offerings.. both of which the biblical god delights in.

    “My take on it is – Jesus wanted me to know that he is with me and lot to loss faith.”

    Tell me… if it by chance had been someone selling vacuum cleaners that knocked on your door would you have taken that as a sign that god was telling you to clean your house? Assigning meanings to random events while ignoring other random events is kind of crazy, don’t you think? If you happen across an atheist billboard somewhere advising you to “Just be good.. for goodness sake”, why don’t you take that as a sign that the universe is telling you there is no god? You put meaning where you WANT to see it.

    “maybe, we would all have the proof we need and stop doubting if he exists – blaming him for the state the world is in and get together to try and fix it.”

    You miss the point. Atheists don’t “blame god” for the state of the world. We simply point to reality as evidence that god is imaginary.

    “God must think we are the biggest pack of idiots – ”
    By definition, god must actually be thinking that we are behaving exactly the way he designed us to… and that everything is unfolding exactly as he planned it, and exactly as he knew it would.
    If an engineer designs a car so that the wheels fall of after 100 miles, why would he be surprised when the wheels fall off after 100 miles? And who’s fault would it be, the car’s, or the engineer’s?
    Sorry, if you are willing to say god is in control, and give him credit for everything good in the world, then you also have to give him credit for everything bad in the world… because according to you.. he made it that way.

    “wonder according to the bible (thanks google) he gets pretty mad in the end and destroys us all in the worst possible way.”

    Much like a master who doesn’t take his dog outside and then beats him to death for going to the bathroom in the house… why does god “destroy us all in the worst possible way” if god is love? And remember, since this is predicted in the bible and supposedly WILL happen according to god’s plan… why is it our fault? We have no choice in the matter. To do so would violate god’s plan and his perfect knowledge!

    Why can’t you see that what you are claiming makes absolutely no sense?

  96. on 13 Mar 2013 at 4:37 pm 96.s0l0m0n said …


    I guess you’re one confuse subject. Be firm with your standings first.

  97. on 13 Mar 2013 at 5:02 pm 97.Anonymous said …

    ah, the return of curmudgeon. One of several sock puppets determined to disrupt the conversation by projecting his trolling onto others to stop questions asked of theists.

    Paula. Dare you answer those questions? Curmudgeon won’t, hence his desire to stop you too. Cue the other sock puppets to bury the questions to Paula under a mound of diversions and other logical fallacies.

  98. on 13 Mar 2013 at 5:45 pm 98.Anonymous said …

    Paula, one more thing. Do you not see that at a time of being emotionally vulnerable and searching for “meaning”, that you took a torturous path in taking a nondescript event and assigning it supernatural provenance?

  99. on 13 Mar 2013 at 10:17 pm 99.Severin said …


    Only a week or two ago you told us that god is not nothing, but is equivalent of nothing.

    What is it now?
    God IS nothing?God EQUALS nothing?
    You believe in nothing?

    Illogical, inconsequential, …, idiot!

  100. on 13 Mar 2013 at 10:39 pm 100.The messenger said …

    on 12 Mar 2013 at 8:02 pm 85.The messenger said …
    Brother 82.DPK, I was wrong for insulting you.
    I let my anger get the better of me, I humbly apologize.
    You should listen to what I preach because I am the bigger man in this confict, because I apologized for my insult; but you still have yet to apologize for the many hateful insults that you have stated about me.

  101. on 13 Mar 2013 at 11:15 pm 101.alex said …

    ” Isn’t funny how atheist who say they know more Bible than Christians but criticize those who use the words of the Bible like love, sin and God.”

    if you stoned adulters and i criticize you and tell you that stoning adulters is bible bullshit, will you find it funny?

  102. on 14 Mar 2013 at 12:41 am 102.alex said …

    “You should listen to what I preach because I am the bigger man in this confict, because I apologized for my insult;”

    what a moron. you get called out on your bullshit and you want apologies? not really sure, that atheists hate you, but the scorn, pity, puzzlement, dread, and other things heaped upon you, is deserved.

    i went to a santa nonbeliever site one time and i argued that i’m a firm, faithful believer in the jolly old elf. surprise, but i got the exact same reception as you, ole mess. now begone! in the name of santa!

  103. on 14 Mar 2013 at 1:21 am 103.DPK said …

    I’m sorry if I have not been forthright with you. Let me set the record straight, I AM very sorry that you are a deluded idiot. I don’t hate you, never have, and I’m not angry with you, never have been.
    Feel better?

  104. on 14 Mar 2013 at 2:10 am 104.The messenger said …

    Brother DPK, you have not only provided conclusive proof that proves my claim of myself being the bigger man in this debate, you have also proven that you are a HYPOCRITE.

    You criticize me when I loose my temper, but you loose your temper and presented your hate towards me within comment 103.
    I pity you.

  105. on 14 Mar 2013 at 2:45 am 105.The messenger said …

    Mr. 102.alex, the only thing that I was called out on, was loosing my temper.

    Therefore, I apologized for my anger, and I respectfully asked DPK to apologize for the times that he lost his temper ( which he failed to do so).

  106. on 14 Mar 2013 at 6:18 am 106.s0l0m0n said …


    But God exist.
    Is that too dumb for you to understand?

  107. on 14 Mar 2013 at 7:47 am 107.Xcanthean Zeno said …

    106.s0l0m0n said …
    But God exist.
    Is that too dumb for you to understand?

    You sir…

    that is all

  108. on 14 Mar 2013 at 8:00 am 108.Xcanthean Zeno said …

    As a brony, i often get hate mail ;D (yay me 9_6 )
    some of which come from thiests who claim i am evil, will go to hell, and basicaly should die for watching the show.
    can any one please explain this?

  109. on 14 Mar 2013 at 8:57 am 109.alex said …

    if your god is nothing, why is the koran full of bullshit? it should only have blank pages. and nothing should be coming out of your mouth, but instead….

    now, shut up and follow your nothing god.

  110. on 14 Mar 2013 at 11:24 am 110.The messenger said …

    Brother DPK, you have not only provided conclusive proof that proves my claim of myself being the bigger man in this debate, you have also proven that you are a HYPOCRITE.

    You criticize me when I loose my temper, but you loose your temper and presented your hate towards me within comment 103.
    I pity you.

    Mr. 102.alex, the only thing that I was called out on, was loosing my temper.

    Therefore, I apologized for my anger, and I respectfully asked DPK to apologize for the times that he lost his temper ( which he failed to do so).

  111. on 14 Mar 2013 at 3:35 pm 111.s0l0m0n said …

    alex rantings have no substance at all.Just fit for the drains.

  112. on 14 Mar 2013 at 7:52 pm 112.DPK said …

    106.s0l0m0n said …
    But God exist.
    Is that too dumb for you to understand?”

    Yes, Solomon… you’ve got it exactly right. That is too dumb for ANYONE to understand. At least you now admit it is dumb.

    So now you see why we reject your claim without reservation… it is a dumb idea presented by a dumb person, and it is presented without any evidence to back it up. You might as well claim that an inter dimensional sea turtle farted the universe into existence out of his inter dimensional asshole, or something completely insane like that!

    yuk yuk yuk….

  113. on 14 Mar 2013 at 8:21 pm 113.The messenger said …

    Solomon, do not listen to DPK.

    You are a vital part of the fight against Atheism.

  114. on 14 Mar 2013 at 11:09 pm 114.alex said …

    “You are a vital part of the fight against Atheism.”

    this is why i curse. fucking muslims and xtians cannot possible coexist, no matter how the progressive theists spin it and there is a fight against atheists?

    messenger, do you even know what bullshit is? if you say something, and i say bullshit, will you fight me?

  115. on 14 Mar 2013 at 11:13 pm 115.DPK said …

    Yes, it is better to believe in ANY crazy ass shit… Even Solomon who ALSO believes messengers god is completely imaginary, or any other god or magical being, rather than none at all.
    Yeah, that makes sense.
    I’m beginning to understand why Alex curses…. We are surrounded by fucking idiots!

  116. on 14 Mar 2013 at 11:17 pm 116.DPK said …

    So how about you William. You think Solomon is “vital” in the fight against non-believers. Do you agree with him that Jesus was NOT the son of god, that your god is false, and that god = nothing?
    He also says you are destined for hell unless you renounce your god and worship his!
    Since you think his opinion is important, I take it you agree with him?
    And you claim I smoke crack and have a mental illness!

  117. on 15 Mar 2013 at 12:49 am 117.s0l0m0n said …

    Me and other theists are allies in matters concerning there should be a deity or God who manages everything. But when come to faith we could discuss and debate and arrive to a conclusion that there must be only one true God almighty.
    So there’s no fuss.

  118. on 15 Mar 2013 at 12:54 am 118.s0l0m0n said …

    But God exist.
    Is that ‘too dumb for you’ to understand?”
    I did’nt mean the issue is dumb.
    I mean it’s you that is too dumb to understand the issue.

  119. on 15 Mar 2013 at 1:57 am 119.DPK said …

    But God exist.
    Is that ‘too dumb for you’ to understand?”
    I did’nt mean the issue is dumb.
    I mean it’s you that is too dumb to understand the issue.

    No, you had it right. It is too dumb to understand.
    Are you too dumb to comprehend that?
    Aparantly so.

    If you are cool with Williams god, or some other god, as long as there is a god… Why do you have a problem with sea turtle? How come you respect messengers beliefs, but not mine?

  120. on 15 Mar 2013 at 5:07 am 120.DPK said …

    “Therefore, I apologized for my anger, and I respectfully asked DPK to apologize for the times that he lost his temper ( which he failed to do so).”

    You mistake my pointing out the flaws in your reasoning and the stupidity of your ideas for anger. It is not. I am not angry at you, and I do not hate you. You are once again projecting your feelings on me. I don’t hate you, I feel sorry for you because you are lavishing devotion and attention to a thing that is a figment of your imagination.
    If you had a friend who spent his days talking to an invisible rabbit, and spent a good deal of his time trying to convince you that his invisible rabbit was real, wouldn’t you feel sorry for him and try to show him that his rabbit was just his imagination?
    You are the person with the invisible rabbit… And know what, William? You know it’s all make believe. That’s why you spend your time here. You are trying to convince yourself, not me, or sev, or Alex or Lou. You are looking for someone to validate you. And look who you found… Crazy ass Solomon who says insane things like god=nothing, but god exists. As if that means anything. Is that what you seek? Validation from a crazy person?

  121. on 15 Mar 2013 at 8:15 am 121.Xcanthean Zeno said …

    /\spot on

    Btw, if any theists can make a VALID reason on how god exists, i will personaly join you religion, so start xD

  122. on 15 Mar 2013 at 9:12 am 122.s0l0m0n said …

    “If you are cool with Williams god, or some other god, as long as there is a god… Why do you have a problem with sea turtle? How come you respect messengers beliefs, but not mine?”

    You are not demonstrating God. You are just fooling around.Tell me which atheists recognize a God?

    I respect messengers beliefs coz he recognizes the existence of one true God.I respect him only up to that point.

  123. on 15 Mar 2013 at 3:15 pm 123.Xcanthean Zeno said …

    you will (((BURN))) in <<>> for your (((BLESPHAMY)))


  124. on 15 Mar 2013 at 4:23 pm 124.s0l0m0n said …

    Xcanthean Zeno has lost all arguments…..

  125. on 15 Mar 2013 at 5:23 pm 125.alex said …

    “Xcanthean Zeno has lost all arguments”

    who fucking cares? i don’t care if you got syphilis from you sheep girlfriend. nobody cares if i have bad grammar of bad keyboard or bad breath.

    your bullshit won’t fly here and your diversions are tiring. your so called proofs are laughable. when somebody tries to paraphrase your proof, you complain? your proof of hell is gaze at the sun? wtf? gaze at the turtle is the same exact bullshit, no? i would rather worship the turtle than deal with your bullshit god.

  126. on 15 Mar 2013 at 7:38 pm 126.DPK said …

    “124.s0l0m0n said …

    Xcanthean Zeno has lost all arguments…..”

    No, he hasn’t. You have.

    I can play this as long as you can….

    yuk yuk yuk…..

    “I respect messengers beliefs coz he recognizes the existence of one true God.I respect him only up to that point.”

    yuk yuk yuk… but messenger does not recognize YOUR god as the one true god. In fact, messenger thinks that in a fight, his Jesus/Yahweh/Holy Ghost god can kick your Alla god’s ass.
    I just think sea turtle is a good compromise that everyone can agree on. Sea turtle doesn’t send people to hell. He’s pretty chill, actually.

    You have never told us why you reject the idea of sea turtle. Why is it any less believable than Mohammad riding to heaven on a winged horse?

  127. on 15 Mar 2013 at 9:11 pm 127.The messenger said …

    Brother 120.DPK, stop spreading lies about me.

    I do recognize Solomon’s God as the one true God.
    We simply have different beliefs regarding God.

  128. on 16 Mar 2013 at 2:03 am 128.s0l0m0n said …

    Talking about horses, think about the phrase below;

    God have made the housefly fly
    Then God could make horses fly too

    yuk yuk yuk…..(not funny at all)

  129. on 16 Mar 2013 at 2:45 am 129.Xcanthean Zeno said …

    god did not make house flies
    and a horse could not physically fly due to weight

    all of your sentences just went kasplody

  130. on 16 Mar 2013 at 8:52 am 130.s0l0m0n said …

    “and a horse could not physically fly due to weight”

    Xcanthean Zeno…you are a f****n idiot.

    Just create bigger wings.

    Case closed.

  131. on 16 Mar 2013 at 8:01 pm 131.The messenger said …

    God could change the molecular structure of the horse making it less dence than oxygen, thus making it fly.

    Or he could make the bones of the horse hollow like a bird, and he could give it bigger wings.

  132. on 16 Mar 2013 at 11:23 pm 132.s0l0m0n said …

    The messenger,

    Atheists just don’t realize what creation can produce.

  133. on 17 Mar 2013 at 12:06 am 133.Anonymous said …

    Useless gods with their “could do this”, let’s talk about the ones that did.

    Look in the night sky, do you not know the constellation Pegasus? Pegasus was a horse that could fly, and Zeus placed him there for us to marvel at. Prove me wrong if you can.

    Those Greek gods really walked the walk. Let’s see Solomon or messengers god do something other than produce excuses. If they can’t prove they exist, we might as well stay with the gods that deliver the goods.

  134. on 17 Mar 2013 at 12:59 am 134.Lou said …

    Anonymouse prove to me you are real. Until you can, you are not and you are just a random dropping of cow dung that has fell on a keyboard.

    Balls in your court.


    You have just described the theory of evolution. With time and natural selection anything is possible, well, at least, that is what biologist would tell us and God is not needed to design these systems.

  135. on 17 Mar 2013 at 1:14 am 135.Anonymous said …

    Poor Lou, stung into action with a story about a god greater than his he responds with his usual personal insults and tiresome diversions.

    Well, seeing as Lou refuses to answer questions here, runs away from them in fact, his post is yet-another attempt to change the subject. I’d say nice try, but I don’t want to lie. Also, it’s hard to be offended by someone as transparent as he is.

    Messenger and Solomon. The Greek gods have you beat. They came and did the flying horse thing way before your lot came on the scene. Sorry, your “could have” excuses are seriously outmatched by their stories.

    Solomon, I’m puzzled though. Doesn’t your boy have the Buraq to boast about? Not as cool as Pegasus by a long shot but how comes your side doesn’t deliver the flying horse goods nowadays?

  136. on 17 Mar 2013 at 4:07 am 136.s0l0m0n said …


    “With time and natural selection anything is possible, well, at least, that is what biologist would tell us and God is not needed to design these systems.”

    Creation does not need evolution,time or natural selection crap.Creation can happen in no time or limits. Pooofff!! and that’s it, a brand new species.

  137. on 17 Mar 2013 at 4:21 am 137.s0l0m0n said …


    Pegasus is just a product of man’s imaginations. See….the true God purposely create the idea of a winged horse during the greek era just to create the real horse much years later.

    It’s that simple…

  138. on 17 Mar 2013 at 11:03 am 138.Xcanthean Zeno said …

    As a person who knows atleast some basic physics and anatomy.
    there is NO way you could get a horse to fly via wings.

  139. on 17 Mar 2013 at 11:13 am 139.DPK said …

    You could strap a rocket to its ass. With sufficient thrust, horses fly just fine.
    Landing would present a different set of problems.
    Yeah, Solomon’s answer to everything is, no need to understand anything. Poof! No explanation necessary.
    If he had his way, we’d still be living in caves and howling at the moon.

  140. on 17 Mar 2013 at 12:24 pm 140.alex said …

    “Pegasus is just a product of man’s imaginations. See….the true God purposely create the idea of a winged horse during the greek era just to create the real horse much years later.”

    i get it. you’re a comedian, but a bad one. your attempt at outrageous is not working. you need new material. enter “da bible”.

  141. on 17 Mar 2013 at 2:07 pm 141.The messenger said …

    Brother 132.s0l0m0n,

    You are correct.

  142. on 17 Mar 2013 at 2:08 pm 142.The messenger said …

    Brother 140.alex, God can do anything.

    Why do you doubt this.

  143. on 17 Mar 2013 at 2:09 pm 143.The messenger said …

    on 16 Mar 2013 at 8:01 pm 131.The messenger said …
    God could change the molecular structure of the horse making it less dence than oxygen, thus making it fly.
    Or he could make the bones of the horse hollow like a bird, and he could give it bigger wings.

  144. on 17 Mar 2013 at 2:59 pm 144.s0l0m0n said …

    Xcanthean Zeno,

    Don’t try to bluff. God just could make anything fly.


    “You could strap a rocket to its ass. With sufficient thrust, horses fly just fine.”

    No….God does not need a rocket to fly the horse. The rocket is a primitive invention discovered billions of years later after God could fly all flying animals with fine wings.

    You’re the primitive lots DPK but you don’t realize.

  145. on 17 Mar 2013 at 10:30 pm 145.showme2 said …

    you couldn’t really address GOD’s existence if you wanted to. GOD is. look around. look up at night. do all the math and physics and chemistry . you’re right . they don’t explain it all …. no beginning, no end. our little brain will just take us so far and GOD is of course beyond that. please get your thinking straightened out and quit listening to these frustrated attention craving nincompoops.

  146. on 18 Mar 2013 at 12:56 am 146.alex said …

    “you couldn’t really address GOD’s existence if you wanted to.”

    santa claus, moron. how’s it different? gtfooh.

  147. on 18 Mar 2013 at 2:35 am 147.The messenger said …

    146.alex, I feel great pain within you brother. Something happened in your past that is corrupting you, and causing you to doupt Jesus.

    You are afraid to believe because you are afraid of being letdown. I promise you, you will not be abandoned by God. He loves you, and he will always love you brother.

  148. on 18 Mar 2013 at 4:19 am 148.s0l0m0n said …

    That’s why the true religion is true.

  149. on 18 Mar 2013 at 6:33 am 149.s0l0m0n said …

    Bravo…!!! showme2….Bravo…..!!

  150. on 18 Mar 2013 at 8:49 am 150.Xcanthean Zeno said …

    Sol said…
    Xcanthean Zeno,
    Don’t try to bluff. God just could make anything fly.

    I dont think you get it…
    Due to weight, there is no physical way a horse could fly without a major physical reshape, even then im not so sure.
    Hollow bones, molecular changes, big wings. It doesnt matter, if you see the largest flight able reptile (cant remember its name, just google it) even in a high oxygen atmosphere, it was only capable of gliding, and it weighed about as much as a small human, yet alone a HORSE ;D. and an albotross, a relitivly small bird, needs an IMMENSE wingspan to fly, a horse would need about….50 feet of wings to fly? which is simply not possible due to a horse being incapable of storing that much muscle.

    Tl’DR version
    horses couldnt fly

  151. on 18 Mar 2013 at 8:50 am 151.s0l0m0n said …

    The messenger,

    Jesus is not God. Don’t bring others to Hell along with you. Please brother…This is a sincere advice.

  152. on 18 Mar 2013 at 9:01 am 152.s0l0m0n said …

    Xcanthean Zeno,

    That’s what you think. It doesn’t matter if the horse needs more than 50 feet wingspan to fly, as long as it can fly is suffice. Able to fly is the topic of this issue.Size doesn’t matter. God had created bigger animals like the whale.The muscle problem is of no significant problem.

  153. on 18 Mar 2013 at 9:09 am 153.s0l0m0n said …

    God could create anything. It only need a bit of creativity. I guess the atheists are not the creative lots.

  154. on 18 Mar 2013 at 9:40 am 154.alex said …

    s0l = nongratisCount#8
    mess = nongratisCount#13

  155. on 18 Mar 2013 at 10:31 am 155.The messenger said …

    on 18 Mar 2013 at 2:35 am 147.The messenger said …
    146.alex, I feel great pain within you brother. Something happened in your past that is corrupting you, and causing you to doupt Jesus.
    You are afraid to believe because you are afraid of being letdown. I promise you, you will not be abandoned by God. He loves you, and he will always love you brother.

  156. on 18 Mar 2013 at 12:15 pm 156.MrQ said …

    horses couldnt fly

    I sense we’ll get some more horse shit flying from Sol. Maybe he means it was a little pink fairy dust sprinkling unicorn that transported his main man to the moon. Unicorns are almost similar to horses, sort of. Does Allan get a free pass on this magic moment, Sol? Ooops, I mean’t “Allah”, of course!!

  157. on 18 Mar 2013 at 6:34 pm 157.alex said …

    mess = nongratisCount#14

  158. on 19 Mar 2013 at 12:49 am 158.s0l0m0n said …


    You couldn’t deny the logic that horses could fly.

  159. on 19 Mar 2013 at 3:23 am 159.The messenger said …

    on 18 Mar 2013 at 10:31 am 155.The messenger said …
    on 18 Mar 2013 at 2:35 am 147.The messenger said …
    146.alex, I feel great pain within you brother. Something happened in your past that is corrupting you, and causing you to doupt Jesus.
    You are afraid to believe because you are afraid of being letdown. I promise you, you will not be abandoned by God. He loves you, and he will always love you brother.

  160. on 19 Mar 2013 at 7:03 am 160.Xcanthean Zeno said …

    152.s0l0m0n said …
    Xcanthean Zeno,
    That’s what you think. It doesn’t matter if the horse needs more than 50 feet wingspan to fly, as long as it can fly is suffice. Able to fly is the topic of this issue.Size doesn’t matter. God had created bigger animals like the whale.The muscle problem is of no significant problem.

    i dont think you get it…
    the amount of muscle that would be needed for a 50 foot wingspan simply could not fit in the horse…unless you made it bigger, which would need exponentially larger wings, and MORE muscle.

    simply put, there is no way a horse can fly with wings.

  161. on 19 Mar 2013 at 7:06 am 161.Xcanthean Zeno said …

    not to mention that a whale sized horse would die from its own weight, and would need over a mile of wingspan and a stupidly high metabolism to survive, and again, would need more muscle than you could fit in it to make it fly.

    please remember that when you square an animal, you cube its weight.

  162. on 19 Mar 2013 at 7:08 am 162.Xcanthean Zeno said …

    Sol said…
    God could create anything. It only need a bit of creativity. I guess the atheists are not the creative lots.

    no, he could not make an ant that weighs a ton.
    he cannot make an insect sized horse.
    he could not make a horse fly via wings.
    he could not make a whale fly.
    he could not make a snail that travels 20 miles per hour.
    want any more impossibilities?

  163. on 19 Mar 2013 at 9:38 am 163.s0l0m0n said …

    Xcanthean Zeno,

    Don’t try to demonstrate more bluffs. Look at the housefly. It’s wings is barely smaller than it’s body. You’re very uncreative Xcanthean Zeno. You’re a lousy designer.

  164. on 19 Mar 2013 at 12:11 pm 164.Anonymous said …

    XZ, you’re being trolled. Solomon is just special-pleading you to death. His response to everything is “well, god could do that”. He needs to prove it, not claim it.

  165. on 19 Mar 2013 at 3:27 pm 165.DPK said …

    Well. if Santa can make reindeer fly, god can make a horse fly. What more explanation do you need beyond that?

    I can’t believe you guys are even dignifying his silliness with a response, and are actually debating the reality of flying horses and which make believe god is more powerful than which.

  166. on 19 Mar 2013 at 4:33 pm 166.s0l0m0n said …


    Reasoning is good enough proof.

  167. on 19 Mar 2013 at 8:21 pm 167.alex said …

    s0l = nongratisCount#9
    mess = nongratisCount#15

  168. on 19 Mar 2013 at 8:56 pm 168.DPK said …

    166.s0l0m0n said …
    Reasoning is good enough proof….

    Proof of the old adage “ignorance is bliss.”

    Follow this Solomon and understand, you simple minded fool: 1. If an all powerful inter-dimensional sea turtle were to fart into the quantum nothingness, that would certainly create a big bang and cause a universe to materialize from his quantum asshole.
    2. Look around, you idiot. There is a universe here, and all evidence points to the fact that it originated in a big bang. So, obviously that proves that the sea turtle not only is real, but my creation story is true. Evidence is undeniable, it is all around you.
    3. You cannot refute this. Your reasoning is weak and pointless.

    yuk yuk yuk….

  169. on 19 Mar 2013 at 8:59 pm 169.The messenger said …

    Solomon, read the following link and you will see that Jesus and God are the same person.


  170. on 19 Mar 2013 at 11:11 pm 170.alex said …

    these fuckers just don’t get it. they fail to see that their arguments used with a different subject/god is exactly the same thing. from jesus to allah is a very small leap, but from ra to zeus to santa is an unbridgeable chasm. hell/heaven is a helpless/hopeless addiction. living an average of 50+ years is not enough, i guess.

  171. on 20 Mar 2013 at 12:51 am 171.s0l0m0n said …

    “1. If an all powerful inter-dimensional sea turtle were to fart into the quantum nothingness, that would certainly create a big bang and cause a universe to materialize from his quantum asshole.”

    The above is ((((RUBBISH)))) & fit for the drains of fame.

  172. on 20 Mar 2013 at 12:54 am 172.s0l0m0n said …

    alex..why don’t you just shut up & only rant

  173. on 20 Mar 2013 at 1:28 am 173.alex said …

    s0l = nongratisCount#10

  174. on 20 Mar 2013 at 2:02 am 174.DPK said …

    “The above is ((((RUBBISH)))) & fit for the drains of fame.”

    No, it isn’t.

    Why? Because YOU say so?
    You think horses can fly.
    I’m right, you’re wrong.

    See how it works Solomon? Things asserted without evidence are dismissed without reason.

  175. on 20 Mar 2013 at 2:04 am 175.The messenger said …

    173.alex, you failed.

  176. on 20 Mar 2013 at 2:05 am 176.The messenger said …

    on 17 Mar 2013 at 2:09 pm 143.The messenger said …
    on 16 Mar 2013 at 8:01 pm 131.The messenger said …
    God could change the molecular structure of the horse making it less dence than oxygen, thus making it fly.
    Or he could make the bones of the horse hollow like a bird, and he could give it bigger wings.

  177. on 20 Mar 2013 at 2:06 am 177.alex said …

    “Things asserted without evidence are dismissed without reason.”

    s0l, comprende? too deep? in sheep?

  178. on 20 Mar 2013 at 2:42 am 178.The messenger said …

    Brother 177.alex, once again you have failed to provide any information supporting your opinion.

    You have failed again. To quote a certain Disney character; Alex “(you are a sad, strange little man, I pity you)”.

  179. on 20 Mar 2013 at 2:47 am 179.The messenger said …

    Brother Alex, God loves all people equally. He does not favor anyone over anyone else, we are all equal under him.

    Suffering occurs in our lives as a test to teach us to keep our moral values even in the face of danger or pain of anykind. If we succeed in staying kind, compassionate, loving, and forgiving people durring our time on Earth, we will go to heaven as soon as we die. But if we live greedy, prideful, hateful, or jealous lives, then we will spend some time in hell until we are sent to purgatory to receive another chance to be good people.

    God experiences more pain than we can possibly imagin, and he does it all for us., because he loves us. He died so that we could go to heaven.

    Alex you are very ungrateful.

  180. on 20 Mar 2013 at 2:54 am 180.DPK said …

    on 19 Mar 2013 at 8:59 pm 169.The messenger said …
    Solomon, read the following link and you will see that Jesus and God are the same person.

    Yeah Solomon, a wiki article describing the transfiguration is “proof”. I mean, there’s even a picture, so it must be true right?

    Now, tell us exactly why you reject messenger’s claim that this is proof of Jesus’ divinity. We really want to know why.

  181. on 20 Mar 2013 at 5:22 am 181.Xcanthean Zeno said …

    Xcanthean Zeno,
    Don’t try to demonstrate more bluffs. Look at the housefly. It’s wings is barely smaller than it’s body. You’re very uncreative Xcanthean Zeno. You’re a lousy designer.

    as i said, as a creatures dimensions are larger, its weight becomes far larger in comparison.
    a fly can fly due to its small size, which allows flight.
    but a horse could not fly due to its weight being far larger in comparison.

    please read about the square to cube rule.

  182. on 20 Mar 2013 at 11:05 am 182.s0l0m0n said …

    as i said, as a creatures dimensions are larger, its weight becomes far larger in comparison.”

    As it’s weight becomes larger, surely it needs more powerful wings. That’s the trick. A more powerful wings.Look at helicopters. A powerful engine & blades makes it possible for it’s huge weight to fly.You’re a bluffer Xcanthean Zeno.

  183. on 20 Mar 2013 at 12:52 pm 183.Xcanthean Zeno said …

    it seems its going to take a lot to get information through your mind.

    you see, a helicopter is far more powerful than muscles when it comes to lift, this is also due to how rotors are more efficient than wings.

    of course having “more powerful wings” seems like the answer, but that makes more implications, such as the muscle mass needed to move those wings, the bone structure to attach the muscles, and the membrane, or feathers to line the wings.
    while you are (semi…) correct about making it simply more powerful, the only way to do this is to increase the density of the muscles, that would require stronger bones and make the whole animal weigh more. Also, a helicopter can convert massive amounts of chemical energy, in the form of high octane fuel. An animal could theoretically do the same via burning sugars, at the size of a horse, the metabolism needed is impossible to accomplish, and even if you could somehow reach the needed metabolism, the poor horse would die from its own cells cooking themselves from the resulting heat.

  184. on 20 Mar 2013 at 12:55 pm 184.Xcanthean Zeno said …

    again, please read the square to cube rule

  185. on 20 Mar 2013 at 12:58 pm 185.Xcanthean Zeno said …

    please read a basic physic/biology book…

  186. on 20 Mar 2013 at 1:36 pm 186.freddies_dead said …

    You’re pissing in the wind XZ s0l doesn’t care about physics or biology.

    s0ls God can do everything that s0l claims He can simply because s0l imagines it to be true – just like he imagines that his God is real.

  187. on 20 Mar 2013 at 4:06 pm 187.s0l0m0n said …

    Xcanthean Zeno,

    You are sighting the physical rules inside your scope of knowledge. As freddies mention “s0ls God can do everything” which is true, God could create materials and systems out of your knowledge which could make the horse possible to fly. Who could have known a heavy helicopter body could fly with the idea or inspiration from God? There could be a possible way that a horse could fly.

  188. on 20 Mar 2013 at 4:14 pm 188.DPK said …

    Look… if superman can fly, why not a horse?
    Makes sense to me.

  189. on 20 Mar 2013 at 5:23 pm 189.s0l0m0n said …

    Xcanthean Zeno,

    How could a horse possibly fly. Think about the gravity of heavenly bodies. A weightless invincible force that could hold other heavenly bodies.So…it doesn’t need a mass to produce an unimaginable amount of power.

    Now take your bluffs somewhere else.

  190. on 20 Mar 2013 at 9:32 pm 190.alex said …

    “Now take your bluffs somewhere else.”

    the irony is wasted on the sheep herder.

    s0l = nongratisCount#10
    mess = nongratisCount#15

    and s0l makes a move for more stupid…

  191. on 21 Mar 2013 at 1:30 am 191.s0l0m0n said …

    “and s0l makes a move for more stupid…”

    alex….don’t just know how to rant “stupid”.

    Join the debate regarding the possibility a horse could fly and point out which part is stupid.If you can’t, it’s quite clear that it’s you who is stupid.

  192. on 21 Mar 2013 at 1:50 am 192.s0l0m0n said …

    Xcanthean Zeno,

    Have you ever heard of the word “ratio”?

    Only by ratio comparison, we could predict the possibility of a flying horse. Compare the horse with one flying animal, the eagle for example.Imagine a horse the weight of an eagles body and wings proportionate to an eagles wing.Then multiply the horse to the size of a normal horse.By ratio the horse wings will also multiply in size.From this reasoning if an eagle could fly so does the horse.

    It’s that simple.

  193. on 21 Mar 2013 at 2:11 am 193.alex said …

    s0l = nongratisCount#11
    mess = nongratisCount#15

    s0l is definitely making a stupid move on mess. he’s got the horse. and the girlfriend sheep.

  194. on 21 Mar 2013 at 2:51 am 194.The messenger said …

    on 20 Mar 2013 at 2:47 am 179.The messenger said …
    Brother Alex, God loves all people equally. He does not favor anyone over anyone else, we are all equal under him.
    Suffering occurs in our lives as a test to teach us to keep our moral values even in the face of danger or pain of anykind. If we succeed in staying kind, compassionate, loving, and forgiving people durring our time on Earth, we will go to heaven as soon as we die. But if we live greedy, prideful, hateful, or jealous lives, then we will spend some time in hell until we are sent to purgatory to receive another chance to be good people.
    God experiences more pain than we can possibly imagin, and he does it all for us., because he loves us. He died so that we could go to heaven.
    Alex you are very ungrateful.

  195. on 21 Mar 2013 at 2:58 am 195.The messenger said …

    192.alex and DPK are tied for this years pointless comment awards.

  196. on 21 Mar 2013 at 3:11 am 196.s0l0m0n said …

    alex’s vocabulary…

    1. non gratis
    2. sheep

  197. on 21 Mar 2013 at 5:21 am 197.Xcanthean Zeno said …

    Er mah gewd…
    s0l is insane…purely insane

  198. on 21 Mar 2013 at 10:02 am 198.alex said …

    “s0l is insane…purely insane”

    no he aint. just attention grab, hey looky me, i so crazy. i say shit to fuck with people.

  199. on 21 Mar 2013 at 10:43 am 199.Xcanthean Zeno said …

    nope, insane, completely insane.
    a person who ignores all evidence, physics and biology, but instead looks up to god.

  200. on 21 Mar 2013 at 12:57 pm 200.s0l0m0n said …

    Xcanthean Zeno,

    “a person who ignores all evidence, physics and biology, but instead looks up to god.”

    I did’nt ignore physics nor biology. Physics or biology is just a process or laws of God governing the essence of happenings or phenomenons.

    It’s you that is ((((INSANE)))) thinking that your own existence is not a product of creation which undergoes physical or biological process controlled by God.

  201. on 21 Mar 2013 at 8:28 pm 201.The messenger said …

    Mr. 198.alex, stop talking like a neandrathal.

  202. on 21 Mar 2013 at 9:08 pm 202.alex said …

    “Mr. 198.alex, stop talking like a neandrathal.”

    because every fucking thing that comes out of your mouth is pure bullshit. it makes me curse/cringe/puke. until you say something with substance, all you get is scorn and/or cursing.

    btw, how the fuck do you talk like a “neandrathal”?

    why do you talk like a bullshitting fuckhead?

  203. on 21 Mar 2013 at 9:17 pm 203.alex said …

    “It’s you that is ((((INSANE)))) thinking that your own existence is not a product of creation ”

    motherfucker, it ain’t up to you to say who’s insane. the essense of this site is “your god is bullshit”. that include your bullsheyat allah, you fucking desert dweller who’s afraid to admit it and who’s afraid ole mess won’t be his buddy anymore.

    unless, you got some shit, shut the fuck up. using your bullshit bible/koran to buttress your bullshit assert is bullshit X bullshit.

    now go back to your sheep.

  204. on 21 Mar 2013 at 11:08 pm 204.DPK said …

    why do you talk like a bullshitting fuckhead?

    Alex gets the award for the most creative use of profanity!!!
    Solomon gets the award for the biggest sheep fucking, shit talking, bullshitting fuckhead!
    Rock on Alex…..
    I def have to remember that one.

  205. on 21 Mar 2013 at 11:18 pm 205.The messenger said …

    202.alex, why do you speak with such hate?

  206. on 22 Mar 2013 at 12:57 am 206.s0l0m0n said …

    It’s crystal clear alex & DPK is out of argument.
    2 – nil
    I (((WIN))).


  207. on 22 Mar 2013 at 5:28 am 207.Xcanthean Zeno said …

    Again, s0l shows his deluded mind by claiming biology and physics as God’s…

  208. on 22 Mar 2013 at 6:56 am 208.s0l0m0n said …

    Xcanthean Zeno,

    Don’t try to twist my statement.

  209. on 22 Mar 2013 at 8:21 am 209.Xcanthean Zeno said …

    s0l said…
    Physics or biology is just a process or laws of God governing the essence of happenings or phenomenons.

    nope, god has nothing to do with it, being that he is an imagination…

  210. on 22 Mar 2013 at 9:40 am 210.s0l0m0n said …

    Xcanthean Zeno,

    ((((NOPE))))….it’s impossible everything that exists except God with it’s intricate designs or systems is not created by one powerful intelligent deity.

  211. on 22 Mar 2013 at 1:15 pm 211.Xcanthean Zeno said …

    No, organisms, even as complex as us, are immensely simple when it comes to design, as a matter of fact, humans are one of the most inefficient designs i have seen for an organism.
    Being that you believe god made us, i assume you do not believe in evolution? or that you believe that in one day, God made every organism?

  212. on 22 Mar 2013 at 3:27 pm 212.s0l0m0n said …

    “No, organisms, even as complex as us, are immensely simple when it comes to design, as a matter of fact, humans are one of the most inefficient designs i have seen for an organism.”

    That is the most irresponsible blatant blind statement.Make a blob of clay walks on its belly if you think it’s simple enough.

    Nothing starts with evolution. Everything except God must start with the 1st. design or blueprint. God don’t just make every organism but he made everything other than himself.

  213. on 22 Mar 2013 at 5:37 pm 213.freddies_dead said …

    210.s0l0m0n said …

    Xcanthean Zeno,

    ((((NOPE))))….it’s impossible everything that exists except God with it’s intricate designs or systems is not created by one powerful intelligent deity.

    So it takes intelligence to create intricate designs. In which case it must take something super intelligent to create the intelligence that can create intricate designs.

    With that in mind, who (or what) created your God? And why don’t you worship that being?

    Of course once you explain that, you can then explain who (or what) created the Super-God that created your bog standard God …. and so on and so forth.

    Infinite regress says you’re talking out of your arse.

  214. on 22 Mar 2013 at 10:27 pm 214.The messenger said …

    Mr. 211.Xcanthean Zeno, you are extremely misinformed.

    God created the ansestors of the animals that are on the Earth today. Gradually the animals that God created evolved into the different kinds of species that are on the Earth today.

  215. on 23 Mar 2013 at 12:24 am 215.s0l0m0n said …


    You’re the ((((DUMBEST)))) person I have ever come across in my entire life. It’s a fatigue job to make you understand.

    1st. I stressed intricate design is limited to things other than God.

    2nd.How many times do I have to stress that God can’t be created coz’
    ((((GOD = NOTHING))))

    Case closed.


  216. on 23 Mar 2013 at 12:27 am 216.Adam said …

    There is sin in the world and that’s why bad things happen.

  217. on 23 Mar 2013 at 12:30 am 217.s0l0m0n said …

    “Infinite regress ”

    Ahhh…..some primitive concept gathered by freddies_dead which is barely relevant.

  218. on 23 Mar 2013 at 2:39 am 218.s0l0m0n said …


    “…….which is barely irrelevant.”

  219. on 23 Mar 2013 at 7:36 am 219.Xcanthean Zeno said …

    s0l said…
    ((((GOD = NOTHING))))

    How many times do you have to say this, if God is nothing, how can he create anything or exist in some form for that matter.

  220. on 23 Mar 2013 at 10:32 am 220.s0l0m0n said …

    Xcanthean Zeno,

    That’s the wonders of God.
    He exists and could create anything but yet he is not equivalent to any of his creations.

    ((((GOD = NOTHING))))

  221. on 23 Mar 2013 at 2:04 pm 221.The messenger said …

    on 22 Mar 2013 at 10:27 pm 214.The messenger said …
    Mr. 211.Xcanthean Zeno, you are extremely misinformed.
    God created the ansestors of the animals that are on the Earth today. Gradually the animals that God created evolved into the different kinds of species that are on the Earth today.

  222. on 24 Mar 2013 at 2:43 am 222.Hell Yeah said …

    “God created the ansestors of the animals that are on the Earth today. Gradually the animals that God created evolved into the different kinds of species that are on the Earth today.”

    Why didn’t God create the animals in the present form from the beginning? Why did he make them so they evolved? I think it is funny how creationists think the answer for everything is goddidit.

    Check this video out. This explains everything:


    You must like humor that proves a point, though.

  223. on 24 Mar 2013 at 4:16 am 223.Xcanthean Zeno said …

    Show me one bible passage that says that.

  224. on 24 Mar 2013 at 4:21 am 224.s0l0m0n said …

    “Gradually the animals that God created evolved into the different kinds of species that are on the Earth today.”


    God created new species ” that are on the Earth today.”

  225. on 24 Mar 2013 at 4:44 am 225.The messenger said …

    222.Xcanthean Zeno, I am not a Liar.

    The information within my comment 221, is a theory that I have concluded by comparing the theory of evolution with the information contained within the bible.
    I have concluded that evolution did occur after God created the original animals and after Noah’s flood. Due to the early time period at which the first animals were made, I have concluded that my theory contained within comment 221 is correct. Even though the bible does not state that God created the ansestors of the animals of 2013, it is logical to say that he did infact create the ansestors of the modern day animals, and those animals that God created in the beginning did infact evolve into the modern animals that we know today.

    Scientific evidence supports this theory.

    Do not live in DENIAL.

  226. on 24 Mar 2013 at 12:16 pm 226.MrQ said …

    To The Mess, who claims:

    those animals that God created in the beginning did infact evolve into the modern animals that we know today.
    Scientific evidence supports this theory.

    Better be careful. This site is populated (polluted?) by strident Hell and Brimstone types who will only concede “micro-“evolution as fact. Be prepared to suffer their scorn and wrath with your flippant comment. You’ll have to back up this assertion. What do you have, science-wise?

  227. on 25 Mar 2013 at 12:48 pm 227.Xcanthean Zeno said …


    i wonder when thiests will look at the facts and see how noahs ark is simply not possible…

  228. on 25 Mar 2013 at 3:44 pm 228.s0l0m0n said …


    Don’t just know how to rant “noahs ark is simply not possible…” Let’s debate on it and point out which part is impossible.

  229. on 25 Mar 2013 at 9:49 pm 229.The messenger said …

    Yes it is possible.

    Comments (9,184)
    Robert Ballard, one of the world’s most famous underwater explorers, has set his sights on proving the existence of one of the Bible’s most well known stories.
    In an interview with ABC’s Christiane Amanpour the archaeologist who discovered the Titanic discussed his findings from his search in Turkey for evidence of a civilization swept away by a monstrous ancient flood.
    “We went in there to look for the flood,” Ballard said. “Not just a slow moving, advancing rise of sea level, but a really big flood that then stayed… The land that went under stayed under.”
    Many have claimed to have discovered evidence of Noah’s Ark, the huge ship that Noah filled with two of each creature to repopulate the planet following God’s devastating flood. But in the 1990s, geologists William Ryan and Walter Pitman gathered compelling evidence that showed a flood–if not an ark–may have occurred in the Middle East region about 7,500 years ago, PBS reports.
    The theory, the Guardian reports, is that a rising Mediterranean Sea pushed a channel through what is now the Bosphorus, submerging the original shoreline of the Black Sea in a deluge flowing at about 200 times the volume of Niagara Falls and extending out for 100,000 square miles.
    Ballard has been exploring this theory for more than a decade, National Geographic reports, first discovering evidence of a submerged ancient shoreline in 1999. At that point, Ballard was still not convinced this was a biblical flood, according to the Guardian. Last year, his team found a vessel and one of its crew members in the Black Sea, according to ABC.
    Ballard is using advanced robotic technology to travel back nearly 12,000 years to a time when much of the Earth was covered in ice, ABC reports. If and when this ice started to melt, massive floods may have surged through parts of the globe, wreaking havoc on anything and anyone in its way.
    With an impressive track record (besides the Titanic, Ballard also found the wreck of the battleship, Bismarck, and a U.S. fleet lost off Guadalcanal in the Pacific) and plenty of confidence, Ballard remains unfazed by critics. He plans on returning to Turkey next summer.
    The story of Noah and his ark is a building block of Genesis, in the Old Testament. It is similar in some respects to the Babylonian epic of Gilgamesh, according to National Geographic, and the ancient Greeks, Romans and Native Americans all have their own variations on legendary flood stories.
    View Gallery
    Jesus Discovery

    CORRECTION: A previous headline on this story suggested that Ballard believed he found evidence of Noah’s Ark. He only found evidence of the flood.

  230. on 26 Mar 2013 at 1:46 am 230.Xcanthean Zeno said …

    Why the flood couldnt of happened.

    1: animals would have killed noah
    2: he couldnt have got the animals

  231. on 26 Mar 2013 at 2:23 am 231.The messenger said …

    Brother 230.Xcanthean Zeno, that is a very weak argument.

    God brought the animals to the ark and helped Noah guide them into the Ark.The animals would not have hurt Noah or his family because God was probably controlling the animals and kept them from hurting Noahsnf his family.
    There, I have just proved that your statements are false.

  232. on 26 Mar 2013 at 2:26 am 232.The messenger said …

    on 26 Mar 2013 at 2:23 am 231.The messenger said … Your comment is awaiting moderation.
    Brother 230.Xcanthean Zeno, that is a very weak argument.

    God brought the animals to the ark and helped Noah guide them into the Ark.The animals would not have hurt Noah or his family because God was probably controlling the animals and kept them from hurting Noah and his family.
    There, I have just proved that your statements are false.

  233. on 26 Mar 2013 at 3:01 am 233.Anonymous said …

    “Let’s debate on it and point out which part is impossible.”

    No. First you need to explain what you believe happened, how it happened, when it happened, and provide verifiable details. Please provide citations so that we can independently read your submission.

    When you have done that, then you can legitimately ask for critique. Until then, you are simply trying to reverse the burden of proof.

  234. on 26 Mar 2013 at 6:58 am 234.Xcanthean Zeno said …

    as many have said from over time.

    God did it, doesn’t count.

    it never has, and never will.

    There has never been a widely known recorded example of god being able to do anything, hence saying god did it doesn’t count.

  235. on 26 Mar 2013 at 1:17 pm 235.MrQ said …

    To The Mess:
    Just asking what science you are using to supported the Ark fable? How did, for example, polar bears and kangaroos manage to swim, hop, and walk from their environmental niches to the mid-east?

    Please enlighten me with this new branch of scientific inquiry. Bibliology?

  236. on 26 Mar 2013 at 5:12 pm 236.DPK said …

    He doesn’t need science. “God did it” overrides any requirement of feasibility, rationality, or actual evidence.

    It’s the ultimate “no-brainer” answer as it doesn’t require the proponent to actually use a brain. Just shrug and say, “I don’t know.. but god can do anything…” except apparently heal amputees or provide any believable evidence that he in fact exists.

    I wonder why messenger failed to answer my direct question in the other thread about the morality he claimed comes from the bible? I mean, all I did was ask him about actual instructions from god himself directly from the bible. But he chose to ignore them. Wonder why that is?

  237. on 26 Mar 2013 at 8:27 pm 237.A said …

    “i wonder when thiests will look at the facts and see how noahs ark is simply not possible…”

    Sigh!, about when atheist look at facts and realize our existence is not possible without a omnipotent Creator.

    Then again, you can prove me wrong.

    First you need to explain what you believe happened, how it happened, when it happened, and provide verifiable details. Please provide citations so that we can independently read your submission. This would be called science, not some philosophy like abiogenesis or macroevolution.

    When you complete this task, I will review it and let you know if you pass your burden of proof.

    Good Luck!

  238. on 26 Mar 2013 at 9:04 pm 238.Anonymous said …

    “Sigh!, about when atheist look at facts and realize our existence is not possible without a omnipotent Creator.”

    Great, finally a statement that has some meat behind it. You know the drill, first you need to explain what you believe happened, how it happened, when it happened, and provide verifiable details. Please provide citations so that we can independently read your submission.

    You made the claim, now lets see the proof for your “omnipotent Creator”.

  239. on 26 Mar 2013 at 9:44 pm 239.The messenger said …

    233.Anonymous, I do not know the exact date when the flood happened, but I estimate that it was several billion years ago.

    I believe that durring this time period, many humans were corrupt, and GOD deciedesd that humans needed to be given another chance to be righteous. So GOD caused the flood and allowed only four humans to live.

  240. on 26 Mar 2013 at 9:47 pm 240.A said …

    LOL! I knew I could stir up Mouse!!

    OK, now that you are here no running. Let me see you prove that our existence CAN and DID happen without an omnipotent creator. As a guide (although on a much smaller level) picture the entire MS Windows 8 OS being created by you randomly typing on your keyboard!

    Remember! you need to explain what you believe happened, how it happened, when it happened, and provide verifiable details. Please provide citations so that we can independently read your submission.

    Got the popcorn! Looking forward to a great exposition!

  241. on 26 Mar 2013 at 9:54 pm 241.The messenger said …

    235.MrQ, those creatures did not exist at that time.

    Their ansestors did, those ansestors later evolved into the hundereds and thousands of species that we know today. Even if those animals were around durring that time period, the wouldn’t have had to swimm to their destination because the contenets had probably not seperated yet.

  242. on 27 Mar 2013 at 12:06 am 242.Anonymous said …

    Not even a good try, Hor. No one need to prove that something didn’t happen according to YOUR contention until you first prove your point has validity. Everything else is your attempt at diversion.

    You keep getting busted and slapped down by me. At some point you’ll realize that your childish insults only reinforce your desperation. But, if all you have are empty retorts, then thanks for showing us how intellectually bankrupt your game actually is.

    Still, you made a statement and we’re willing to let you go ahead and expand upon it. It’s your claim, the burden is all yours. We’re waiting.

  243. on 27 Mar 2013 at 12:29 am 243.alex said …

    “Remember! you need to explain what you believe happened, how it happened, when it happened, and provide verifiable details.”

    you’re a moron. some atheists might claim to know, but they’re suspect too, just like you.

    no one knows, except you. now, who’s got something to prove? your god, the mayans, the greeks, the vikings, dpk’s turtle are all bullsheeyyaat.

    stop the nonsense about atheists not taking a stance. i just know you’re about to roll it out again. you’re the one with the bullshit claim, now back it up.

    just because i can’t explain the gifts under the tree doesn’t mean santa did it, you fuckhead.

  244. on 27 Mar 2013 at 1:22 am 244.A said …

    Popcorn in hand, waiting for a great show and Mouse drops a dud!


    You were not asked to prove something did not happen. You were, however, asked to explain what you believe happened, how it happened, when it happened, and provide verifiable details. Please provide citations so that we can independently read your submission.

    Simple? If there was no God, then nature must be responsible right? Try again and be a man this time.

  245. on 27 Mar 2013 at 1:24 am 245.A said …


    Still clever as ever! You are such a breath of fresh air. You really are the poster child for atheism. Please never leave the blog.

    Love ya bro!

  246. on 27 Mar 2013 at 1:25 am 246.A said …

    “just because i can’t explain the gifts under the tree doesn’t mean santa did it”

    Seriously? You don’t know how the gifts got under your tree?


  247. on 27 Mar 2013 at 1:43 am 247.alex said …

    “You really are the poster child for atheism.”

    no. there’s no atheist poster child, there’s no atheist bullshit pope, no atheist leader, none. atheists don’t believe in your bullshit god, got it?

    “Seriously? You don’t know how the gifts got under your tree?”

    no, motherfucker, i’m an idiot. what does that make you, with your “goddidit” bullshit?

    now, tell me how the gifts got there?

  248. on 27 Mar 2013 at 1:47 am 248.alex said …

    “Try again and be a man this time.”

    as oppossed to being a woman, a fag, a nigger, a wetback, a liberal? c’mon theist, don’t stop there, bring it all the way…. fucken shit.

  249. on 27 Mar 2013 at 2:09 am 249.The messenger said …

    242.Anonymous, you constant babbling and lack of grammar is appalling and filled with failed attempts at fabricating a sturdy and unbreachable/ impregnable fortress compiled of an inain, whimsical diversion. Your pitiful, feeble attempt has failed. I pity you.

  250. on 27 Mar 2013 at 4:37 am 250.DPK said …

    The Astrophysicist returns after his last trouncing to once again attempt to shift the burden of proof and declare his version of reality must be true unless someone can prove it false.
    I have already given you a complete explainaton of creation without need of an omnipotent god… The magical inter dimensional sea turtle. You have yet to disprove any of it… So by your reasoning, it is true.
    “A”do you also subscribe to messengers contention that Noah existed “several billion years ago” and that all humans are then direct descendants of the 4 people that survived the flood?
    I take it you do, since you have not offered any evidence to the contrary.
    You don’t learn much in Astrophysict school, did ya there, big boy?

  251. on 27 Mar 2013 at 4:52 am 251.The messenger said …

    Brother 250.DPK, I have given you all proof of Jesus’s existance. You are in denial.

  252. on 27 Mar 2013 at 4:54 am 252.The messenger said …

    250.DPK, humans multiply quickly.

  253. on 27 Mar 2013 at 5:08 am 253.DPK said …

    Messenger… Do you realize that Homo sapiens first appeared only about 200 thousand years ago, and that nothing even remotely akin to a human existed “several billion” years ago?
    Seriously, your asshole must be really sore from you constantly pulling all this utter bullshit out of it. Thank you though, for demonstrating once again the utter insanity of of religious beliefs. You do atheism proud son. You are the poster child of theist stupidity.

  254. on 27 Mar 2013 at 7:52 am 254.Xcanthean Zeno said …

    “several billion” years ago

    I think you went full retard…

  255. on 27 Mar 2013 at 12:08 pm 255.freddies_dead said …

    215.s0l0m0n said …


    You’re the ((((DUMBEST)))) person I have ever come across in my entire life.

    Have you looked in a mirror lately?

    It’s a fatigue job to make you understand.

    I understand your rubbish perfectly. I guess you just don’t like the fact that I’m happy to show you that it’s rubbish.

    1st. I stressed intricate design is limited to things other than God.

    So God isn’t intricate? So intricate design can come from simpler beginnings? Thanks for admitting evolution is true.

    2nd.How many times do I have to stress that God can’t be created coz’
    ((((GOD = NOTHING))))

    You can stress it till your balls go green and turn up at the corners it won’t make it any more true.

    Case closed.

    Lol, you didn’t have a case in the first place.


    I’m sorry you find thinking hard. Maybe if you stopped trying to cram all those logical fallacies into your worldview it’d be a bit easier.

    217.s0l0m0n said …

    “Infinite regress ”

    Ahhh…..some primitive concept gathered by freddies_dead which is barely relevant.

    It doesn’t matter how primitive you believe the concept to be, it still destroys your creationist claims.

    218.s0l0m0n said …


    So you should be.

    “…….which is barely irrelevant.”

    Meaning you’ve finally grasped how it is relevant. Well done you. Now answer the criticism that your creationist claims end up as an infinite regress.

  256. on 27 Mar 2013 at 1:43 pm 256.MrQ said …

    Mess, I asked you about Noah’s Ark. How did polar bears and kangaroos manage to make the journey?
    You replied:

    235.MrQ, those creatures did not exist at that time.

    I ask you what is “that time”? Are we talking billions of years ago? Thousands? Where did your information come from? Please provide a source. Are you a bibliologist?

  257. on 27 Mar 2013 at 2:03 pm 257.s0l0m0n said …


    “Just asking what science you are using to supported the Ark fable? How did, for example, polar bears and kangaroos manage to swim, hop, and walk from their environmental niches to the mid-east?”

    It’s purely simple.

    Polar bears and kangaroos exists within the area where the arc is build.

    Case closed.


  258. on 27 Mar 2013 at 2:07 pm 258.s0l0m0n said …


    What freddies_dead can only do is just twisting of words without substance.

    No need to bother…no doctrines or impact at all to the truth of the true religion…..relax….


  259. on 27 Mar 2013 at 5:32 pm 259.Anonymous said …

    A said “Sigh!, about when atheist look at facts and realize our existence is not possible without a omnipotent Creator”.

    We are still waiting for you to tell us what those “facts” are, and to prove to us how that leads to an “omnipotent creator”.

    Why are you so afraid to provide proof for your claims?

  260. on 27 Mar 2013 at 5:42 pm 260.A said …

    Aw!!! another failure for Mouse. Why are you so afraid Mouse to defend anything? It is all materialism and science, Right? That should be simple to defend. One more shot for you mate and then we will have to label you a failure.

  261. on 27 Mar 2013 at 6:13 pm 261.Anonymous said …

    Thanks for proving that all you have are lies and excuses, Horatio. You can’t honestly think anyone falls for your nonsense, can you.

    If it makes you feel good to call someone a failure for not attempting your diversion about something they never said, go ahead. If it helps ease your embarrassment at the ease with which we call out your games, then have that one for free. After all, your only approach these days seems to be to parrot what people say to you. As a theist, thinking for yourself wouldn’t exactly be your strong point would it?

    So, threaten people with insults all you like. It’s not like anyone should be upset by being called names by someone who suffers from the personality disorders you consistently demonstrate to the world. So, have at it. Your insults have as much truth as do your claims.

    Finally, you may think it’s a victory to divert attention from Solomon and Messenger’s predicaments, but we know than none of you answer questions anyway. But then, it’s increasingly looking as if all of those are more of your sock-puppets or butt-buddies anyway.

  262. on 27 Mar 2013 at 6:26 pm 262.DPK said …

    Just curious why ASSman isn’t demanding that messenger provide proof of his absolutely absurd claim that Noah and the great flood occurred “at least several billion years ago” which would put it somewhere squarely in the Precambrian era.
    See, messenger gets a free pass from the Asstrophysicist because he believes in Jeezhus, so Ass doesn’t feel threatened by him.
    God, ASS, you’re such a total dickhead. You, messenger and Solomon would make a great sideshow on the Christopher Hitchens memorial book tour! They could charge $5 for people to just laugh at you.

  263. on 27 Mar 2013 at 6:50 pm 263.Anonymous said …

    “They could charge $5 for people to just laugh at you”.

    They should sell season tickets.

  264. on 27 Mar 2013 at 6:54 pm 264.A said …


    You personal attacks and diversions will not take us from the facts. You failed and horribly. Your own words have been required of you and you cannot fulfill the requirement.

    I had to embarass you to show just what a fraud and troll you really are. You and Alex are free to go trolling. It is what you and Alex do best.

  265. on 27 Mar 2013 at 8:01 pm 265.MrQ said …

    A (aka The Hor, likely) has become the equivalent of the pigeon on the chessboard, strutting and shitting.
    This little man (and I do mean little in every form imaginable ;-) ) prances around like a little git, tries to ridicule opponents, and then runs. Hey, that defines exactly what he is – a troll.
    In summary (and it’s really easy to summarize this) he says I am smart and you’re not….so there. The default argument, and that is all he’s got, is goddidit. Arks, winged horses, zombies, no problem.
    Too bad he won’t honestly engage in a debate, but then he would look even more ridiculous, if that’s at all possible.

  266. on 27 Mar 2013 at 10:05 pm 266.alex said …

    “Why are you so afraid to provide proof for your claims?”

    there is no atheist claim! all these things that atheists say is a direct result of the bullshit you fuckers keep slinging about.

    atheists don’t believe in your bullshit god and all that other shit you keep bringing up is just fluff.

    now, who put the gifts under the tree? god? you said it wasn’t santa.

  267. on 27 Mar 2013 at 10:07 pm 267.DPK said …

    He has, in the past, attempted to engage in debate, and has been trounced multiple time on all points, and now even his sock puppets have holes in them from being through the ringer so many, many times. That’s why now he only resort to trolling and never engages anyone in anything remotely like an honest attempt at debate.
    “La, la, la, la… I can’t HEAR you cause my fingers are in my ears.” is all this sad man has left. Which is pretty disgusting, considering that the only 2 places his fingers reside are in his ears and up his arse.

    Hey Ass… do they have any statues of 2 billion year old humans in the Creation Museum there at Liberty? Preferably ones who could build an ark the size of an aircraft carrier out of wood?

  268. on 27 Mar 2013 at 10:22 pm 268.The messenger said …

    253.DPK, I never said that it was 7 billion years ago.

    The bible states that God created the Earth first. But it does not say how long it was before he did anything with it.

  269. on 27 Mar 2013 at 10:24 pm 269.alex said …

    if somebody says “i believe something created the universe”, i’ll prolly agree because it’s one of the last two defaults after all the other possibilities are postulated. the other one is: “nothing created the universe”.

    which of the last two defaults has the higher probability? are they the same?

  270. on 28 Mar 2013 at 1:49 am 270.Biff said …


    Here is your big chance. You can actually engage in credible discussion rather than attacks and crude language.

    If you can answer one question we can put this entire matter to rest. How did evolution create DNA? Now you must be able to to develop a credible theory that starts immediately after the Big Bang and that would account for the multiple DNA codes realizing the DNA varies based on what task the cell is to perform.

    Anyone with any education this field would naturally assume something this complex and high functioning would require an Intelligent agent to write this code,

    You are, however, asked to explain what you believe happened, how it happened, when it happened, and provide verifiable details. Please provide citations so that we can independently read your submission.

    If successful, I will take up your cause.

    Good Luck.

  271. on 28 Mar 2013 at 2:04 am 271.DPK said …

    Biff buffed
    “Anyone with any education this field would naturally assume something this complex and high functioning would require an Intelligent agent to write this code,”

    Actually not even close to true. A recent poll of 270 highly educated scientists in the field of evolutionary biology shoed that 80% of them do not believe in god. In fact, only two of those that responded to the poll claimed to be “theists”.

    So, now that your premise is trashed, care to provide any evidence or credible scientific research that shows your “required intelligent agent” actually exists?
    Then you can explain how such a highly complex intelligence came to be without an even higher intelligence to design it, since your claim is that such a thing would be impossible.

    Otherwise, you are once again talking out of your ass. No surprise there.
    Good luck.

  272. on 28 Mar 2013 at 2:33 am 272.alex said …

    “How did evolution create DNA?”

    how the fuck do i know? this is a legitimate answer to your full fledged diversionary tactic.

    you want me to say evolution is bullshit? fine, i’ll say it. but, it doesn’t validate your burnt flesh craving, virgin promising, foreskin obsessed, murderous, fantasy god!

    biff, give it up. why do you keep fucking with atheists. are you concerned? shouldn’t you be happy i’m going to your fantastic hell?

  273. on 28 Mar 2013 at 7:25 am 273.Xcanthean Zeno said …


    please remember this Blog is not about evolution, it is about god, and how he does not exist.
    Not all atheists believe in evolution, but all have the disbelief of god.

  274. on 28 Mar 2013 at 7:34 am 274.MrQ said …

    From The Biffy

    How did evolution create DNA?

    Evolution and abiogenesis confusion again?

    Evolution deals with changes in DNA. Shall we start that debate? If so (and don’t you run away, Biffy) let’s agree that our planet Earth is a few billion years old and humans have been around for less than one million years.

    I provide a reference from a christian (no less) website so that you can study the information and we’ll get the ball rolling.
    Check out: http://biologos.org/questions/ages-of-the-earth-and-universe

    Don’t disappoint the character “A” who earlier on this thread posted comments such as:

    OK, now that you are here no running.

    I had to embarass you to show just what a fraud and troll you really are

    One more shot for you mate and then we will have to label you a failure.

    Or you too will suffer his stinging wrath in a personal attack!!!!

    Balls in Biffy’s court.

  275. on 28 Mar 2013 at 7:40 am 275.Anonymous said …

    Have you guys noticed that when Solomon and Messenger were running around squawking that A and his cronies were absent? Then, Solomon and Messenger both got cornered and ran away to be replaced themselves by Lou, then A, then Biff who, when cornered, ran away thus repeating not just the cycle but the exact same arguments?

    Lou and A and Biff are the same person, we already know that. Messenger has been posting as four different people already, I’m not sure about Solomon but a pattern emerges.

    Engaging these sock-puppets is pointless, it gives them the attention they can’t get in real life.

  276. on 28 Mar 2013 at 10:32 am 276.A said …


    A nice try but these atheist only desire adolescent games. Rhonda likes Rich and A is really Lou etc etc. Notice they never answer a question nor engage in any discussion. The blog for them is trying to guess which poster is another poster.

    It takes courage to stand for something and they repeatedly show they have none. alex, the one with such a limited vocabulary, at least admits his own ignorance. It does getting boring in here with the same old prairie dogs.

  277. on 28 Mar 2013 at 1:37 pm 277.alex said …

    “alex, the one with such a limited vocabulary, at least admits his own ignorance.”

    more attacks because you ain’t got shit. are you saying that having your beliefs is far and away better than ignorance of such subject matters as evolution or quantum mechanics.

    you don’t know shit about me or my intelligence, yet you continually spout off more bullshit? but it doesn’t really matter does it? i already admitted, i’m the most ignorant, crazy, broke, ugly, etc person on the planet, but it doesn’t change a thing about your bullcorn, god does it?

  278. on 28 Mar 2013 at 3:00 pm 278.DPK said …

    ” Notice they never answer a question nor engage in any discussion.”

    It does not serve your position very well when the only way you can try to make a point is by lying about it.
    When, posing under your alter ego of “Biff” you stated;
    “Anyone with any education this field would naturally assume something this complex and high functioning would require an Intelligent agent to write this code,”

    I answered your question and engaged you by pointing out the flaw in your straw man argument. The fact is the majority of people with “eduction in this field” in fact do NOT believe it requires am “Intelligent agent” to explain. So why would I spend time debating against a demonstrably false premise.

    If I said “Anyone with an advanced degree in meteorology would assume that lightning bolts do not strike the earth with the agency of a god of thunder and lighting, like Thor or Zeuss, to create them and hurl them toward the earth.” Would it then be reasonable of me to demand that you “explain what you believe happened, how it happened, when it happened, and provide verifiable details. Please provide citations so that we can independently read your submission.”, or would it be acceptable for you to simply reject my claim out of hand because I haven’t provided any evidence or reason to believe that Thor or Zeuss actually exist?

    You are such a twit, straw me, special pleadings, reversing the burden of proof…. fact is, if you had any evidence for your imaginary god you would have presented it long ago and shut everyone up… but you have none, so instead you flog your dead horse and do the pigeon dance… but no one is buying it “A”, except maybe messenger… but he thinks Noah and his family lived several billion years ago… so much for your supporter’s level of intellect.

  279. on 28 Mar 2013 at 3:03 pm 279.DPK said …


    ” …lightning bolts do not strike the earth withOUT the agency of a god of thunder and lighting, like Thor or Zeuss, to create them…”

  280. on 28 Mar 2013 at 4:14 pm 280.freddies_dead said …

    258.s0l0m0n said …


    What freddies_dead can only do is just twisting of words without substance.

    At least you concede that your words are without substance. There was no need for me to twist them to show this. Just demonstrating where they conflict with reality was enough.

    No need to bother…no doctrines or impact at all to the truth of the true religion…..relax….

    An admission that s0l has no answer. Not a surprise. If he did have a way to rebut the criticism he would be only too happy to give it.


    Maybe if you took your fingers out of your ears and stopped muttering your mantra you might learn something – like how your God is purely imaginary.

  281. on 28 Mar 2013 at 7:49 pm 281.Biff said …

    So not a single atheist could answer one question to put the entire argument to bed? It is all materialism, natural laws and evolution. Are these not all facts? Why is the one question so difficult for highly evolved atheists?

  282. on 28 Mar 2013 at 8:04 pm 282.DPK said …

    “So not a single atheist could answer one question to put the entire argument to bed?”

    Certainly we did… can’t you read?
    There is no evidence to suggest that your magical god exists. Until you provide that, there is no “argument”.

    How dense are you?

  283. on 28 Mar 2013 at 8:39 pm 283.A said …

    Zeno said:

    “Not all atheists believe in evolution, but all have the disbelief of god.”

    Who are these atheist who deny evolution and what do they believe? According to High Priest Dawkins, evolution is fact.

    Why can’t atheist get together on what they believe?


    DNA was created by Time & Chance is atheist land. I understand many atheists are waiting for Ferraris to evolve in their driveways

  284. on 28 Mar 2013 at 9:11 pm 284.alex said …

    “According to High Priest Dawkins, evolution is fact.”

    more bullshit. dawkins is not a high priest. based on the bullshit you spout on a regular basis, you are the bullshit high priest.

    “Who are these atheist who deny evolution and what do they believe? ”

    who gives a fuck? just you and youse attempts to derail. your god is bullshit and it doesn’t matter what i think, what i wear, or what i believe in.

    “I understand many atheists are waiting for Ferraris to evolve in their driveways”

    is this your proof? pfft! failed diversion, again.

  285. on 28 Mar 2013 at 9:19 pm 285.DPK said …

    “I understand many atheists are waiting for Ferraris to evolve in their driveways”

    You can add that to the long list of things that you claim to understand about which you are 100% wrong. Can’t you ever type even 2 sentences in sequence without one of them being an absolute lie?

    “Why can’t atheist get together on what they believe?”

    Atheists are quite “together” on what they believe. They believe that your postulated god is just another in a long line of myths and fairytales… just like all the other gods in which you also disbelieve.

    God you are tiresome. Don’t you ever get weary of just being WRONG… all the time? Surely it must weigh on you, otherwise you wouldn’t be on here looking for validation from people who think humans were building giant boats in the Precambrian period. Such a waste of a life.

  286. on 28 Mar 2013 at 9:27 pm 286.The messenger said …

    284.alex, you have once again failed to answer A’s questions.

    And you make excuses and diversions in a lame attempt at covering it up.

  287. on 28 Mar 2013 at 9:32 pm 287.The messenger said …

    285.DPK, you are the one who speaks lies.

    Me and A only speak the truth.

    You on the other hand, fail to realize that GOD is real, even through I have presented proof of him.

    You and Alex are both delusional, ignorant, and in denial.

  288. on 28 Mar 2013 at 11:27 pm 288.A said …

    “They believe that your postulated god is just another in a long line of myths”

    Actually that is untrue too. 21% of atheist even believe in God. They are quite a confused bunch.


    Can’t answer any questions
    Don’t believe in evolution or maybe they do
    Believe in God
    Some do believe in Buddhism and Taoism.
    We do agree they are a complete mess.

  289. on 28 Mar 2013 at 11:29 pm 289.A said …

    “Not all atheists believe in evolution, but all have the disbelief of god.”

    Actually that is incorrect. A Pew survey found 21% of atheist believe in God.

    Couldn’t add the link due to moderation but check it for yourself.

    Can’t answer any questions
    Don’t believe in evolution or maybe they do
    Believe in God
    Some do believe in Buddhism and Taoism.
    We all do agree they are a complete mess.

  290. on 29 Mar 2013 at 12:00 am 290.DPK said …

    “Actually that is incorrect. A Pew survey found 21% of atheist believe in God.”

    Probably the dumbest thing you have ever written, and for you, that is saying something!
    Atheist: noun
    a person who denies or disbelieves the existence of a supreme being or beings.

    If a person believes in gods, they cannot by definition, be atheist.
    Really getting desperate now, Hor… Hahaha. It’s ok. We expect no less of you.
    Now, are you going to provide any actual evidence that your god actually exists? Or will you continue to be just a fart in the wind.

  291. on 29 Mar 2013 at 12:03 am 291.DPK said …

    Most likely explanation is that 21% of theists are too stupid to know what “atheist” means.

  292. on 29 Mar 2013 at 12:10 am 292.alex said …

    “284.alex, you have once again failed to answer A’s questions.”

    i don’t give a fuck about your questions because it doesn’t matter. what matters is that your god is bullshit and you can’t do nuttin about it.

    troll motherfucker 20X. that’s right, profanity is all you get.

  293. on 29 Mar 2013 at 12:25 am 293.alex said …

    Can’t answer any questions
    Don’t believe in evolution or maybe they do
    Believe in God
    Some do believe in Buddhism and Taoism.

    focus, you lamebrained theist. how do the above statements prove your god? it’s another failed diversion. your god/hell/heaven bullshit is slowly being exposed as to what it is, and you can’t do shit about it. you keep trying anyways, but fuck you and your god(s)? all thousands of them.

  294. on 29 Mar 2013 at 12:38 am 294.alex said …

    “Actually that is incorrect. A Pew survey found 21% of atheist believe in God.”

    let’s say 99.99999999999% of all people believes in God, you happy? now, where’s your god proof?

  295. on 29 Mar 2013 at 12:52 am 295.A said …

    Oh DPK you are Such an old fart (pew!)

    We simply redefine the word like”gay marriage” Atheist just means clueless now!! Lol!!

    The most likely explanation is atheists don’t believe anything because they don’t know anything. They prove that here daily.

  296. on 29 Mar 2013 at 12:58 am 296.Fluttershy said …

    Some stupid guy said..
    Who are these atheist who deny evolution and what do they believe?

    Please read what an atheist is…

    (Btw, this is Xcanthean Zeno’s new permanent name…)

  297. on 29 Mar 2013 at 1:01 am 297.MrQ said …

    From The Biffy:

    not a single atheist could answer one question to put the entire argument to bed?……..Why is the one question so difficult for highly evolved atheists?

    Errr, ummmm, scroll up to #274.

    Biffy, careful not to get “A” angry with you (He is a highly educated Astrophysicist after all). He’s all about the cohesive nature of theistic belief. Let’s take a moment so we can examine that statement:

    Theists all believe in winged horses, oh but maybe some don’t.
    Some catholics and baptists are evolution advocates, A says it’s a shit theory.
    Zombies, arks, talking snakes, Vishna, Thor, Allah, jayzus, jehovah, .
    Holy crap, maybe -understandably- they can be just a little confused about what pony to put their money on…
    But we know know how messed up that theist group can be, don’t we Biffy?

  298. on 29 Mar 2013 at 1:22 am 298.alex said …

    “The most likely explanation is atheists don’t believe anything because they don’t know anything.”

    wrong again, asshole, with your typical bullshit nonsense. line up your favorite fellow fuckshits here and let’s compare IQs, GRE scores, salaries, criminal records or any other “knowing” metric you like, with some random atheists here and see how they compare. wanna try it?

    i recognize you’re trolling, but your bullshit will not be tolerated.

  299. on 29 Mar 2013 at 1:32 am 299.The messenger said …

    Mr. 292.alex, Jesus could turn you into a block of salt. Yet he chooses to show you mercy, despite your stupidity and arrogance.

  300. on 29 Mar 2013 at 1:39 am 300.The messenger said …

    297.alex, Here is a list of some of the most decpicable, murderuos people who ever lived, and they are all Athiests. Athiest are cold blooded.

    Mass killings under Communist regimes
    Part of the series on

    Marxist philosophy
    Marxian economics
    Historical materialism
    Surplus value
    Mode of production
    Class struggle
    Classless society
    Proletarian internationalism
    Workers’ self-management
    World revolution
    People’s democratic dictatorship
    Communist state
    Communist party
    Communist revolution
    Communist symbolism
    Communism and religion
    History of communism
    Socialism with Chinese
    Religious (Christian)
    List of communist parties
    Communist League
    Gracchus Babeuf
    Karl Marx
    Friedrich Engels
    Peter Kropotkin
    Rosa Luxemburg
    Karl Liebknecht
    Antonio Gramsci
    Vladimir Lenin
    Leon Trotsky
    Joseph Stalin
    Leonid Brezhnev
    Kim Il-Sung
    Mao Zedong
    Deng Xiaoping
    Ho Chi Minh
    Palmiro Togliatti
    Josip Broz Tito
    Fidel Castro
    Che Guevara
    Related topics
    Cold War
    Criticisms of communism
    Criticisms of communist party rule
    Dictatorship of the proletariat
    Left-wing politics
    New Class
    New Left
    Socialist economics
    “Workers of the world, unite!”
    insurgency (India)
    Communism portal
    Mass killings occurred under some Communist regimes during the twentieth century with an estimated death toll numbering between 85 and 100 million.[1] Scholarship focuses on the causes of mass killings in single societies, though some claims of common causes for mass killings have been made. Some higher estimates of mass killings include not only mass murders or executions that took place during the elimination of political opponents, civil wars, terror campaigns, and land reforms, but also lives lost due to war, famine, disease, and exhaustion in labor camps. There are scholars who believe that government policies and mistakes in management contributed to these calamities, and, based on that conclusion combine all these deaths under the categories “mass killings”, democide, politicide, “classicide”, or loosely defined genocide. According to these scholars, the total death toll of the mass killings defined in this way amounts to many tens of millions; however, the validity of this approach is questioned by other scholars. As of 2011, academic consensus has not been achieved on causes of large scale killings by states, including by states governed by communists. In particular, the number of comparative studies suggesting causes is limited. The highest death tolls that have been documented in communist states occurred in the Soviet Union under Joseph Stalin, in the People’s Republic of China under Mao Zedong, and in Cambodia under the Khmer Rouge. The estimates of the number of non-combatants killed by these three regimes alone range from a low of 21 million to a high of 70 million.[2][dubious – discuss] There have also been killings on a smaller scale in North Korea, Vietnam, and some Eastern European and African countries.


    ShowProposed causes

    ShowComparison to other mass killings

    ShowStates where mass killings have occurred


    ShowNotable executioners

    ShowLegal prosecution for genocide and genocide denial

    ShowSee also



    ShowFurther reading

    ShowExternal links

    ShowRead in another language

    Last modified 6 hours ago

  301. on 29 Mar 2013 at 1:42 am 301.The messenger said …

    Alex, here is one of those idiotic, murderuos Athiests that I mentioned.

    Mao Zedong
    “Mao” redirects here. For other uses, see Mao (disambiguation).
    This is a Chinese name; the family name is Mao.
    Mao Zedong

    Official 1960–1966 portrait of Mao Zedong
    1st Chairman of the Central Committee of the Communist Party of China
    In office
    June 19, 1945 – September 9, 1976
    1st vice-chairman Liu Shaoqi
    Lin Biao
    Zhou Enlai
    Hua Guofeng
    Preceded by Himself (as Central Politburo Chairman)
    Succeeded by Hua Guofeng
    1st Chairman of the Central Politburo of the Communist Party of China
    In office
    March 20, 1943 – April 24, 1969
    Preceded by Zhang Wentian
    (as Central Committee General Secretary)
    Succeeded by Himself (as Central Committee Chairman)
    1st Chairman of the CPC Central Military Commission
    In office
    August 23, 1945 – 1949
    September 8, 1954 – September 9, 1976
    Preceded by Position created
    Succeeded by Hua Guofeng
    1st Chairman of the National Committee of the CPPCC
    In office
    September 21, 1949 – December 25, 1954
    Honorary Chairman
    December 25, 1954 – September 9, 1976
    Preceded by Position Created
    Succeeded by Zhou Enlai
    1st Chairman of the People’s Republic of China
    In office
    September 27, 1954 – April 27, 1959
    Premier Zhou Enlai
    Deputy Zhu De
    Preceded by Position Created
    Succeeded by Liu Shaoqi
    Member of the
    National People’s Congress
    In office
    September 15, 1954 – April 18, 1959
    December 21, 1964 – September 9, 1976
    Constituency Beijing At-large
    Personal details
    Born December 26, 1893
    Shaoshan, Hunan
    Died September 9, 1976 (aged 82)
    Resting place Chairman Mao Memorial Hall, Beijing
    Nationality Chinese
    Political party Communist Party of China
    Spouse(s) Luo Yixiu (1907–1910)
    Yang Kaihui (1920–1930)
    He Zizhen (1930–1937)
    Jiang Qing (1939–1976)
    Religion None (atheist)

    This article contains Chinese text. Without proper rendering support, you may see question marks, boxes, or other symbols instead of Chinese characters.
    Mao Zedong
    Simplified Chinese ???
    Traditional Chinese ???
    Hanyu Pinyin Máo Zéd?ng
    [m??? ts??t???]
    – Romanization Mô Chhe?t-tûng
    – Hanyu Pinyin Máo Zéd?ng
    [m??? ts??t???]
    – Wade–Giles Mao Tse-tung
    – Hokkien POJ Mô? Te?k-tong
    Cantonese (Yue)
    – Jyutping mou4 zaak6dung1
    Chairman Mao
    Chinese ???
    – Hanyu Pinyin Máo zh?xí
    Cantonese (Yue)
    – Jyutping Mou4 zyu2zik6
    Mao Zedong (simplified Chinese: ???; traditional Chinese: ???; pinyin: Máo Zéd?ng, also transliterated as Mao Tse-tung listen (help·info)), commonly referred to as Chairman Mao (December 26, 1893 – September 9, 1976), was a Chinese communist revolutionary, and political theorist. The founding father of the People’s Republic of China from its establishment in 1949, he governed the country as Chairman of the Communist Party of China until his death. In this position he converted China into a single-party socialist state, with industry and business being nationalized under state ownership and socialist reforms implemented in all areas of society. Politically a Marxist-Leninist, his theoretical contribution to the ideology along with his military strategies and brand of policies are collectively known as Maoism.

    Born the son of a wealthy farmer in Shaoshan, Hunan, Mao adopted a Chinese nationalist and anti-imperialist outlook in early life, particularly influenced by the events of the Xinhai Revolution of 1911 and May Fourth Movement of 1919. Coming to adopt Marxism-Leninism, he became an early member of the Communist Party of China (CPC), soon rising to a senior position. In 1922, the Communists agreed to an alliance with the larger Kuomintang (KMT), a nationalist revolutionary party, whom Mao aided in creating a revolutionary peasant army and organizing rural land reform. In 1927 the KMT’s military leader Chiang Kai-shek broke the alliance and set about on an anti-communist purge; in turn, the CPC formed an army of peasant militia, and the two sides clashed in the Chinese Civil War. Mao was responsible for commanding a part of the CPC’s Red Army, and after several setbacks, rose to power in the party by leading the Long March. When the Empire of Japan invaded China in 1937, sparking the Second Sino-Japanese War, Mao agreed to a united front with the KMT, resulting in a CPC-KMT victory in 1945. The Chinese Civil War then resumed, in which Mao led the Red Army to victory as Chiang and his supporters fled to Taiwan.

    In 1949 Mao proclaimed the foundation of the People’s Republic of China, a one-party socialist state controlled by the Communist Party. After solidifying the reunification of China through his Campaign to Suppress Counterrevolutionaries, Mao enacted sweeping land reform, overthrowing the feudal landlords before seizing their large estates and dividing the land into people’s communes. He proceeded to lead a nationwide political campaign known as the Great Leap Forward from 1958 through to 1961, designed to modernize and industrialize the country, however agrarian problems worsened by his policies led to widespread famine. In 1966, he initiated the Cultural Revolution, a program to weed out counter-revolutionary elements in Chinese society, which continued until his death.

    A deeply controversial figure, Mao is regarded as one of the most important individuals in modern world history.[1] Supporters praise him for modernizing China and building it into a world power, through promoting the status of women, improving education and health care, providing universal housing and raising life expectancy.[2][3] In addition, China’s population almost doubled during the period of Mao’s leadership,[4] from around 550 to over 900 million.[3] As a result, Mao is still officially held in high regard by many Chinese as a great political strategist, military mastermind, and savior of the nation. Maoists furthermore promote his role as a theorist, statesman, poet, and visionary, who has inspired revolutionary movements across the globe.[5] In contrast, critics have labeled him a dictator whose administration oversaw systematic human rights abuses, and whose rule is estimated to have caused the deaths of 40–70 million people mainly through starvation, forced labor and executions, placing his rule at the top of the list of most people killed by democide in human history.[6][7][8][9]

    ShowEarly life

    ShowEarly revolutionary activity

    ShowCivil War

    ShowLeadership of China




    ShowPersonal life

    ShowWritings and calligraphy

    ShowPortrayal in film and television

    ShowSee also


    ShowExternal links

    ShowRead in another language

    Last modified 7 hours ago

    Page by contributors like you
    Content available under CC BY-SA 3.0 | Terms of Use

  302. on 29 Mar 2013 at 1:47 am 302.The messenger said …

    Alex, here is another one of your murderuos brethren.

    Joseph Stalin
    “Stalin” redirects here. For other uses, see Stalin (disambiguation).
    Joseph Stalin
    ????? ????????????? ?????? (Russian)
    ????? ?????????? ?? ??????? (Georgian)

    General Secretary of the Communist Party of the Soviet Union
    In office
    3 April 1922 – 16 October 1952
    Preceded by Vyacheslav Molotov
    (as Responsible Secretary)
    Succeeded by Nikita Khrushchev
    (office reestablished)
    Chairman of the Council of Ministers
    In office
    6 May 1941 – 5 March 1953
    First Deputies Nikolai Voznesensky
    Vyacheslav Molotov
    Preceded by Vyacheslav Molotov
    Succeeded by Georgy Malenkov
    People’s Commissar for Defense of the Soviet Union
    In office
    19 July 1941 – 25 February 1946
    Premier Himself
    Preceded by Semyon Timoshenko
    Succeeded by Nikolai Bulganin
    after vacancy
    Member of the Secretariat
    In office
    3 April 1922 – 5 March 1953
    Full member of the Presidium
    In office
    25 March 1919 – 5 March 1953
    Member of the Orgburo
    In office
    16 January 1919 – 5 March 1953
    Personal details
    Born 18 December 1878
    Gori, Tiflis Governorate, Russian Empire
    Died 5 March 1953 (aged 74)
    Kuntsevo Dacha near Moscow, Russian SFSR, Soviet Union
    Resting place Kremlin Wall Necropolis, Moscow, Russian Federation
    Nationality Georgian
    Political party Communist Party of the Soviet Union
    Spouse(s) Ekaterina Svanidze (1906–1907)
    Nadezhda Alliluyeva (1919–1932)
    Children Yakov Dzhugashvili, Vasily Dzhugashvili, Svetlana Alliluyeva
    Religion None, formerly Georgian Orthodox
    Military service
    Allegiance Soviet Union
    Service/branch Soviet Armed Forces
    Years of service 1943–1953
    Rank Marshal of the Soviet Union (1943–1945)
    Generalissimus of the Soviet Union (1945–1953)
    Commands All (supreme commander)
    Battles/wars World War II

    Joseph Vissarionovich Stalin (Russian: ????? ????????????? ??????; born Ioseb Besarionis je J?u?ašvili, pronounced [i?s?b b?sari?nis dze d?u?a?vili] Georgian: ????? ?????????? ?? ?????????; 18 December 1878[1] – 5 March 1953) was the de facto leader of the Soviet Union from the mid-1920s until his death in 1953. Among the Bolshevik revolutionaries who took part in the Russian Revolution of 1917, Stalin was appointed General Secretary of the party’s Central Committee in 1922. He subsequently managed to consolidate power following the 1924 death of Vladimir Lenin through expanding the functions of his role, all the while eliminating any opposition. He held this nominal post until abolishing it in 1952, concurrently serving as the Premier of the Soviet Union after establishing the position in 1941.

    Under Joseph Stalin’s rule, the concept of “socialism in one country” became a central tenet of Soviet society. He replaced the New Economic Policy introduced by Lenin in the early 1920s with a highly centralised command economy, launching a period of industrialization and collectivization that resulted in the rapid transformation of the USSR from an agrarian society into an industrial power.[2] However, the economic changes coincided with the imprisonment of several million people in Soviet correctional labour camps[3] and the deportation of many others to remote areas.[3] The initial upheaval in agriculture disrupted food production and contributed to the catastrophic Soviet famine of 1932–1933, known as the Holodomor in Ukraine. Later, in a period that lasted from 1936–39, Stalin instituted a campaign against alleged enemies of his regime called the Great Purge, in which hundreds of thousands were executed. Major figures in the Communist Party, such as the old Bolsheviks, Leon Trotsky, and several Red Army leaders were killed after being convicted of plotting to overthrow the government and Stalin.[4]

    In August 1939, Stalin entered into a non-aggression pact with Nazi Germany that divided their influence within Eastern Europe, but Germany later violated the agreement and launched a massive invasion of the Soviet Union in June 1941. Despite heavy human and territorial losses, Soviet forces managed to halt the Nazi incursion after the decisive battles of Moscow and Stalingrad. After defeating the Axis powers on the Eastern Front, the Red Army captured Berlin in May 1945, effectively ending the war in Europe for the Allies.[5][6] The Soviet Union subsequently emerged as one of two recognized world superpowers, the other being the United States.[7] The Yalta and Potsdam conferences established communist governments loyal to the Soviet Union in the Eastern Bloc countries as buffer states, which Stalin deemed necessary in case of another invasion. He also fostered close relations with Mao Zedong in China and Kim Il-sung in North Korea.

    Stalin led the Soviet Union through its post-war reconstruction phase, which saw a significant rise in tension with the Western world that would later be known as the Cold War. During this period, the USSR became the second country in the world to successfully develop a nuclear weapon, as well as launching the Great Plan for the Transformation of Nature in response to another widespread famine and the Great Construction Projects of Communism. In the years following his death, Stalin and his regime have been condemned on numerous occasions, most notably in 1956 when his successor Nikita Khrushchev denounced his legacy and initiated a process of de-Stalinization. He remains a controversial figure today, with many regarding him as a tyrant;[8] however, popular opinion within the Russian Federation is mixed.[9][10][11]

    ShowEarly life

    ShowRevolution, Civil War, and Polish-Soviet War

    ShowRise to power

    ShowChanges to Soviet society, 1927–1939

    ShowCalculating the number of victims

    ShowWorld War II, 1939–1945

    ShowPost-war era, 1945–1953

    ShowDeath and aftermath

    ShowPersonal life


    ShowHypotheses, rumors and misconceptions about Stalin


    ShowSee also


    ShowExternal links

    ShowRead in another language

    Last modified 7 days ago

    Page by contributors like you
    Content available under CC BY-SA 3.0 | Terms of Use

  303. on 29 Mar 2013 at 2:08 am 303.The messenger said …

    Alex, here is one more evil man, I mean Athiest. Due to the crazed look in his eye, and the apperiance of a primitive savage, I would suspect that you and him share similar thoughts.

    Karl Marx
    “Marx” redirects here. For other uses, see Marx (disambiguation).
    Karl Marx

    Marx in 1875
    Born Karl Heinrich Marx
    5 May 1818
    Trier, Kingdom of Prussia
    Died 14 March 1883 (aged 64)
    London, United Kingdom
    Residence Germany, United Kingdom
    Nationality Prussian, German
    Era 19th-century philosophy
    Region Western Philosophy, German philosophy
    Religion Protestantism; later, none (atheist)
    School Marxism, Communism, Socialism, Materialism
    Main interests Politics, economics, philosophy, sociology, labour, history, class struggle,
    Notable ideas Co-founder of Marxism (with Engels), surplus value, contributions to the labor theory of value, class struggle, alienation and exploitation of the worker, The Communist Manifesto, Das Kapital, materialist conception of history
    Influenced by
    Hegel, Feuerbach, Spinoza, Proudhon, Stirner, Smith, Voltaire, Ricardo, Vico, Rousseau, Shakespeare, Goethe, Helvetius, d’Holbach,[1]Liebig,[2]Darwin, Fourier, Robert Owen, B?lcescu, Hess, Hupay, Guizot, Pecqueur,[3]Aristotle, Epicurus
    Lenin, Stalin, Trotsky, Mao, Tito, Hoxha, Castro, Guevara, Ho, Sartre, Simone de Beauvoir, Luxemburg, Lukács, Gramsci, Korsch, Bloch, Kropotkin, Bakunin, Marcuse, Deleuze, Debord, Negri, Taussig, Roy, Laclau, Bourdieu, Schumpeter, Habash, Aflaq, Newton and many others
    Part of a series on

    Theoretical works
    The Communist Manifesto
    A Contribution to the
    Critique of Political Economy
    Das Kapital
    The Eighteenth Brumaire of
    Louis Napoleon
    The German Ideology
    Economic and Philosophical
    Manuscripts of 1844
    Theses on Feuerbach
    Dialectical materialism
    Economic determinism
    Historical materialism
    Marx’s method
    Marxian socialism
    Scientific socialism
    Technological determinism
    Capital (accumulation)
    Capitalist mode of production
    Crisis theory
    Means of production
    Mode of production
    Law of value
    Socialist mode of production
    Surplus product
    Surplus value
    Value form
    Wage labor
    Base and superstructure
    Class consciousness
    Class struggle
    Commodity fetishism
    Cultural hegemony
    Human nature
    Private property
    Relations of production
    Working class
    Marx’s theory of history
    Historical materialism
    Historical determinism
    Anarchism and Marxism
    Dictatorship of the proletariat
    Primitive capital accumulation
    Proletarian revolution
    Proletarian internationalism
    World revolution
    Stateless communism
    Marxist philosophy
    Dialectical materialism
    Philosophy in the Soviet Union
    Marxist philosophy of nature
    Marxist humanism
    Marxist feminism
    Libertarian Marxism
    Democratic Marxism
    Marxist autonomism
    Marxist geography
    Marxist literary criticism
    Structural Marxism
    Situationist International
    Young Marx
    Open Marxism
    Council communism
    Democratic socialism
    Left communism
    Revolutionary socialism
    Social democracy
    Karl Marx
    Friedrich Engels
    Karl Kautsky
    Eduard Bernstein
    James Connolly
    Georgi Plekhanov
    Rosa Luxemburg
    Vladimir Lenin
    Joseph Stalin
    Leon Trotsky
    Che Guevara
    Mao Zedong
    Louis Althusser
    Georg Lukács
    Karl Korsch
    Antonio Gramsci
    Antonie Pannekoek
    Rudolf Hilferding
    Guy Debord
    Socialism portal
    Philosophy portal
    Karl Heinrich Marx (German pronunciation: [ka???l ?ha?n??ç ?ma???ks], 5 May 1818 – 14 March 1883) was a Prussian-German philosopher and revolutionary socialist. His ideas played a significant role in the establishment of the social sciences and the development of the socialist movement. Marx’s work in economics laid the basis for our understanding of labor and its relation to capital, and has influenced much of subsequent economic thought.[4][5][6][7] He published numerous books during his lifetime, the most notable being The Communist Manifesto (1848) and Capital (1867–1894).

    Born into a wealthy middle-class family in Trier in the Prussian Rhineland, Marx studied at the University of Bonn and the University of Berlin, where he became interested in the philosophical ideas of the Young Hegelians. After his studies, he wrote for a radical newspaper in Cologne, and began to work out his theory of dialectical materialism. He moved to Paris in 1843, where he began writing for other radical newspapers and met Fredrick Engels, who would become his life-long friend and collaborator. In 1849 he was exiled and moved to London together with his wife and children where he continued writing and formulating his theories about social and economic activity. He also campaigned for socialism and became a significant figure in the International Workingmen’s Association.

    Marx’s theories about society, economics and politics—collectively known as Marxism—hold that human societies progress through class struggle: a conflict between an ownership class that controls production and a proletariat that provides the labour for production. He called capitalism the “dictatorship of the bourgeoisie,” believing it to be run by the wealthy classes for their own benefit; and he predicted that, like previous socioeconomic systems, capitalism produced internal tensions which would lead to its self-destruction and replacement by a new system: socialism.[8] He argued that under socialism society would be governed by the working class in what he called the “dictatorship of the proletariat”, the “workers’ state” or “workers’ democracy”.[9][10] He believed that socialism would eventually be replaced by a stateless, classless society called communism. Along with believing in the inevitability of socialism and communism, Marx actively fought for the former’s implementation, arguing that social theorists and underprivileged people alike should carry out organised revolutionary action to topple capitalism and bring about socio-economic change.[11]

    Revolutionary socialist governments espousing Marxist concepts took power in a variety of countries in the 20th century, leading to the formation of such socialist states as the Soviet Union in 1922 and the People’s Republic of China in 1949. Many labour unions and workers’ parties worldwide were also influenced by Marxist ideas, while various theoretical variants, such as Leninism, Stalinism, Trotskyism, and Maoism, were developed from them. Marx is typically cited, with Émile Durkheim and Max Weber, as one of the three principal architects of modern social science.[12] Marx has been described as one of the most influential figures in human history.[13][14]

    ShowEarly life

    ShowCommunist agitation

    ShowLife in London



    ShowSelected bibliography

    ShowSee also


    ShowFurther reading

    ShowExternal links

    ShowRead in another language

    Last modified 4 days ago

    Page by contributors like you
    Content available under CC BY-SA 3.0 | Terms of Use

  304. on 29 Mar 2013 at 2:33 am 304.DPK said …

    So, assman admits that the only way his claims can possibly make any sense is if he “redefines” words to mean what they actual don’t. Typical theist self delusion.
    Now, why should anyone think you are anything more than a complete imbecile?
    Maybe we should redefine the word “lie” to mean anything horatiio says.

  305. on 29 Mar 2013 at 11:49 am 305.alex said …

    “Mr. 292.alex, Jesus could turn you into a block of salt. Yet he chooses to show you mercy…”

    and i could turn you into a piece of turd, but i can’t because your stupidity cloak is neutralizing my power. your threats are laughable. why not zeus’ lightning bolts? try meeting me somewhere and physically threaten me and see what happens.

    your cut/paste shit is garbage. the compilation of evil theists way outnumber yours, but it doesn’t matter and any sane person understands that. not you of course, the saltBlock ass-assin.

    you don’t believe in santa? hitler didn’t either, so using your logic, you must believe. what kind of fucking thinking is that?

    i know, i know, don’t feed the troll, but the bullshit must pass no mo.

  306. on 29 Mar 2013 at 12:55 pm 306.Biff said …

    The reason atheist claim to believe in God in a Pew survey is embarrassment. If we have any let me offer up the question posed earlier. This question can convert me and every other Christian to your position.

    How did evolution create DNA? Now you must be able to to develop a credible theory that starts immediately after the Big Bang and that would account for the multiple DNA codes realizing the DNA varies based on what task the cell is to perform.

    Anyone with any education and an understanding of Information theory would naturally assume something this complex and high functioning would require an Intelligent agent to write this code. SAS, Oracle, etc don’t wait on nature to develop their codes.

    You are, however, asked to explain what you believe happened, how it happened, when it happened, and provide verifiable details. Please provide citations so that we can independently read your submission.

  307. on 29 Mar 2013 at 1:16 pm 307.alex said …

    306.Biff said …

    your pseudo intellectual pleading is crap. a nonbeliever on ANY subject matter is not obligated to provide any alternatives to the postulated position.

    if you say the face on mars was created by aliens, the non believer’s stance is solid. to advance the cause, the alien proponents must provide proof.

    same shit with your god. i could offer zeus or s0l could offer his sheep/allah god, but foolish we will all look.

    let’s just say that evolution, DNA, aliens, spontaneous appearances, worms holes and everything else we know are all bullshit. it still doesn’t prove your god.

    “…would naturally assume something this complex and high functioning would require an Intelligent agent…”

    and who coded your god? see this shit?

  308. on 29 Mar 2013 at 2:40 pm 308.DPK said …

    “306.Biff said …

    The reason atheist claim to believe in God in a Pew survey is embarrassment.”

    The only thing that is an embarrassment is you thinking this lame statement means anything. An atheist who claims to believe in god is like a singer who is mute… a contradiction in terms. It is embarrassing to theists that they are so stupid and deluded they can’t even comprehend what “atheist” means. Let’s spell it out for you again Biff/A… if you believe in god, you are NOT an atheist. Period.

    “Anyone with any education and an understanding of Information theory would naturally assume something this complex and high functioning would require an Intelligent agent to write this code.”

    How stupid are you? This is a straw man argument. It is simply NOT true. The overwhelming majority of people with advanced degrees in biology do not believe in the requirement of this “intelligent agent”. So, once again, you lie. And the fact that you continue to try and rely on a straw man to rail against after being outed for the utter stupidity it is only shows the level of desperation you apply to maintain your delusion.

    There was a time in human history when no one understood the mechanics of geology, geothermal activity, and plate tectonics. That did not then mean that magical volcano gods where real.

    The level to which your idiocy rises is really beyond comprehension.

    Now, if you have evidence that 80% of the most highly educated, knowledgeable scientists in the field of evolutionary biology are wrong, and that you can demonstrate that a non-physical, non-temporal, non-created, eternal, omnipotent, omniscient and omni-benevolent being actually created the first strand of DNA… well, show us.
    Otherwise we simply continue to laugh at your inane ramblings.

  309. on 29 Mar 2013 at 4:37 pm 309.MrQ said …

    Biffy bleated:

    How did evolution create DNA?

    It didn’t. I think evolution deals with genetic changes over time. Like when us -humans- evolved. Some, such as yourself, still need to evolve further ;-) .

    The greatest and most magnificent record of history is written in your DNA. You cannot run from it, no matter how many gods you choose to believe in.

  310. on 29 Mar 2013 at 5:01 pm 310.A said …

    Biff I would like to answer. It never happened. DNA being orderly, precise and complex would require intelligence. I observe that truth in life and unless one of our scholars lol!! presents a a better answer, I will stick with it.

    Amazing, not one even attempts an answer.

  311. on 29 Mar 2013 at 5:36 pm 311.DPK said …

    “309.A said …

    Biff I would like to answer.”

    Biff say, “Sure, other me… I’m sure whatever you say will fit perfectly with the inane statements I have made, since we have in fact been shown to be the same person.”

    “A” “Yes Biff, you are certainly the smartest person here, next to me. You know how to show those dirty atheists that we don’t need to worry about things like logic, or truth, or even if our statements are provably false. After all, we believe in Ja-heez-zus, so if we want to claim human were here on earth and sufficiently evolved enough to build a wooden boat big enough to carry 2 of every species of animal on the earth with some stone tools and a forearm for measurements… during the Precambrian period no less.. well we can, because you and I know these thing better than any stupid scientist… right, other me?”

    “A” you are certainly welcome to wallow in your own willful ignorance. No one is denying you that right… but here is the reality.

    According to your line of reasoning, if you cannot explain the exact nature and function of dark matter in the universe, then that means that my sea turtle hypothesis is correct, because it explains it perfectly. Dark matter was expelled from the turtle’s ass at the moment of the big bang… it is “dark” because, well, turtle poop is dark, and it provides a repulsive force to all the matter in the universe in much the same way as people avoid you when you walk into a room. It’s very nature is repulsive.

    Until you present a better answer, it is undeniably obvious that I am correct. So, what do you say… wanna explain dark matter and dark energy?

    Maybe you could pray to Jeeh-zus to help you out of the hole you’ve dug your self into.

  312. on 29 Mar 2013 at 6:01 pm 312.MrQ said …

    Allow me to analyze what we all know as “the ridiculously obvious”:

    A/Biff come from the same lineage of human ancestors who looked at the volcano and boldly proclaimed that the wrath of (insert name of some god here) is upon us for our insolence/lack of belief/hairy knuckles.

    Wonder what would happen if NASA did indeed find evidence of life on Mars? No doubt the goal posts would require a major retrofit, yet again!! We all know that their faith would remain -slightly shaken and permanently confused- but the parameters to test and question their belief of a god change. Tis’ the life of the theist – wilful ignorance is truly blissful.

  313. on 29 Mar 2013 at 6:47 pm 313.alex said …

    “Amazing, not one even attempts an answer.”

    what about, “the mooslim motherfucking goddit”. allah met your jesus and proceeded to kick the shit out of him? like it? moron.

  314. on 29 Mar 2013 at 8:01 pm 314.The messenger said …

    305.alex l am not the stung you .

    I was warning you .

  315. on 29 Mar 2013 at 8:13 pm 315.DPK said …

    “willful ignorance is truly blissful…”

    Probably not as much as you might think… if they had “bliss” they would not be here in a seemingly endless, and apparently fruitless, search for validation. Truth is, they are simply trying to convince themselves.

    When the day comes that science explains the exact process from which life evolved from simpler chemistry, they will either deny it, or claim it as the brilliant work of their god, scrambling for whatever nook and cranny they can find to sequester their faith in the god with the ever shrinking role in reality. But, for them, there will always be a crack or crevice to stick him in… because they want there to be.

    You need no more proof of their self fulfilling delusion than their continued assertion that anyone educated in life sciences would “naturally assume” that organic chemistry would require an “Intelligent agent” when the simple fact is that the overwhelming majority of those highly educated people in fact believe exactly the opposite. But they are never ones to let a little thing like truth or reality get in the way of their delusion.

    What is surprising to me is that they keep coming back for more and more embarrassment… and they make no apologies for the outright lies they tell in order to try to maintain the facade of their delusion. Biff/Boz/Hor/Ass cannot write a single post here without getting outed for the liar he is… but it doesn’t seem to phase him. No wonder he thinks he has a personal relationship with the creator of the universe… who loves him, no less!

  316. on 29 Mar 2013 at 10:26 pm 316.The messenger said …

    Here is an Athiest who is a mass murder.

  317. on 29 Mar 2013 at 10:35 pm 317.The messenger said …

    Joseph Stalin
    “Stalin” redirects here. For other uses, see Stalin (disambiguation).
    Joseph Stalin
    ????? ????????????? ?????? (Russian)
    ????? ?????????? ?? ??????? (Georgian)

    General Secretary of the Communist Party of the Soviet Union
    In office
    3 April 1922 – 16 October 1952
    Preceded by Vyacheslav Molotov
    (as Responsible Secretary)
    Succeeded by Nikita Khrushchev
    (office reestablished)
    Chairman of the Council of Ministers
    In office
    6 May 1941 – 5 March 1953
    First Deputies Nikolai Voznesensky
    Vyacheslav Molotov
    Preceded by Vyacheslav Molotov
    Succeeded by Georgy Malenkov
    People’s Commissar for Defense of the Soviet Union
    In office
    19 July 1941 – 25 February 1946
    Premier Himself
    Preceded by Semyon Timoshenko
    Succeeded by Nikolai Bulganin
    after vacancy
    Member of the Secretariat
    In office
    3 April 1922 – 5 March 1953
    Full member of the Presidium
    In office
    25 March 1919 – 5 March 1953
    Member of the Orgburo
    In office
    16 January 1919 – 5 March 1953
    Personal details
    Born 18 December 1878
    Gori, Tiflis Governorate, Russian Empire
    Died 5 March 1953 (aged 74)
    Kuntsevo Dacha near Moscow, Russian SFSR, Soviet Union
    Resting place Kremlin Wall Necropolis, Moscow, Russian Federation
    Nationality Georgian
    Political party Communist Party of the Soviet Union
    Spouse(s) Ekaterina Svanidze (1906–1907)
    Nadezhda Alliluyeva (1919–1932)
    Children Yakov Dzhugashvili, Vasily Dzhugashvili, Svetlana Alliluyeva
    Religion None, formerly Georgian Orthodox
    Military service
    Allegiance Soviet Union
    Service/branch Soviet Armed Forces
    Years of service 1943–1953
    Rank Marshal of the Soviet Union (1943–1945)
    Generalissimus of the Soviet Union (1945–1953)
    Commands All (supreme commander)
    Battles/wars World War II

    Joseph Vissarionovich Stalin (Russian: ????? ????????????? ??????; born Ioseb Besarionis je J?u?ašvili, pronounced [i?s?b b?sari?nis dze d?u?a?vili] Georgian: ????? ?????????? ?? ?????????; 18 December 1878[1] – 5 March 1953) was the de facto leader of the Soviet Union from the mid-1920s until his death in 1953. Among the Bolshevik revolutionaries who took part in the Russian Revolution of 1917, Stalin was appointed General Secretary of the party’s Central Committee in 1922. He subsequently managed to consolidate power following the 1924 death of Vladimir Lenin through expanding the functions of his role, all the while eliminating any opposition. He held this nominal post until abolishing it in 1952, concurrently serving as the Premier of the Soviet Union after establishing the position in 1941.

    Under Joseph Stalin’s rule, the concept of “socialism in one country” became a central tenet of Soviet society. He replaced the New Economic Policy introduced by Lenin in the early 1920s with a highly centralised command economy, launching a period of industrialization and collectivization that resulted in the rapid transformation of the USSR from an agrarian society into an industrial power.[2] However, the economic changes coincided with the imprisonment of several million people in Soviet correctional labour camps[3] and the deportation of many others to remote areas.[3] The initial upheaval in agriculture disrupted food production and contributed to the catastrophic Soviet famine of 1932–1933, known as the Holodomor in Ukraine. Later, in a period that lasted from 1936–39, Stalin instituted a campaign against alleged enemies of his regime called the Great Purge, in which hundreds of thousands were executed. Major figures in the Communist Party, such as the old Bolsheviks, Leon Trotsky, and several Red Army leaders were killed after being convicted of plotting to overthrow the government and Stalin.[4]

    In August 1939, Stalin entered into a non-aggression pact with Nazi Germany that divided their influence within Eastern Europe, but Germany later violated the agreement and launched a massive invasion of the Soviet Union in June 1941. Despite heavy human and territorial losses, Soviet forces managed to halt the Nazi incursion after the decisive battles of Moscow and Stalingrad. After defeating the Axis powers on the Eastern Front, the Red Army captured Berlin in May 1945, effectively ending the war in Europe for the Allies.[5][6] The Soviet Union subsequently emerged as one of two recognized world superpowers, the other being the United States.[7] The Yalta and Potsdam conferences established communist governments loyal to the Soviet Union in the Eastern Bloc countries as buffer states, which Stalin deemed necessary in case of another invasion. He also fostered close relations with Mao Zedong in China and Kim Il-sung in North Korea.

    Stalin led the Soviet Union through its post-war reconstruction phase, which saw a significant rise in tension with the Western world that would later be known as the Cold War. During this period, the USSR became the second country in the world to successfully develop a nuclear weapon, as well as launching the Great Plan for the Transformation of Nature in response to another widespread famine and the Great Construction Projects of Communism. In the years following his death, Stalin and his regime have been condemned on numerous occasions, most notably in 1956 when his successor Nikita Khrushchev denounced his legacy and initiated a process of de-Stalinization. He remains a controversial figure today, with many regarding him as a tyrant;[8] however, popular opinion within the Russian Federation is mixed.[9][10][11]

    ShowEarly life

    ShowRevolution, Civil War, and Polish-Soviet War

    ShowRise to power

    ShowChanges to Soviet society, 1927–1939

    ShowCalculating the number of victims

    ShowWorld War II, 1939–1945

    ShowPost-war era, 1945–1953

    ShowDeath and aftermath

    ShowPersonal life


    ShowHypotheses, rumors and misconceptions about Stalin


    ShowSee also


    ShowExternal links

    ShowRead in another language

    Last modified 9 hours ago

  318. on 29 Mar 2013 at 10:39 pm 318.The messenger said …

    I have heard some people say that GOD did not cause the Black Plague in Europe.

    I disagree. I believe that GOD manipulated those infected fleas to latch on to those rats and guided them to the Italian boats so that Europe would be cleansed of all the despicable people there.

  319. on 29 Mar 2013 at 11:00 pm 319.Nan said …

    The greatest thing about science is it continues to point to God. In Darwin’s s day they once claimed infinite universe, simple cells, etc but now science claims a definite beginning just as God stated. The cell is incredibly complex, pointing to a Creator.

    Cheering on science to reveal more of God’s incredible work.

  320. on 29 Mar 2013 at 11:04 pm 320.DPK said …

    As predicted, not one of the theist will even attempt an answer as to the nature of dark matter and dark energy. Proof the turtle did it!
    How sad for them and their impotent god.

  321. on 29 Mar 2013 at 11:14 pm 321.alex said …

    “… science claims a definite beginning just as God stated.”

    nice! so you believe in the god, Isis? well, hallelujah! when’s the trip to egypt?

  322. on 29 Mar 2013 at 11:21 pm 322.Biff said …

    Let me rephrase the question so it is even simpler.

    When I look at DNA and the high information content, why should I believe it was created by nature? What in nature would suggest it is even possible? No God claim here, asking how nature could pull this off. For a reference check into information theory.

    Unfortunately what we will see is volcano god, santa, elves and profanity but at least they are being exposed for those who may be lurking.

  323. on 29 Mar 2013 at 11:39 pm 323.alex said …

    “Unfortunately what we will see is volcano god, santa, elves and profanity”

    these are the direct result of your(s) bullshit assertions. they are exactly like your god, meritless!

    don’t you get it? other postulations have varying degrees of suspect, but your god is at the top of the heap, along with the others you mentioned. nobody truly knows how it all began, but your god(s) didn’t do it because god(s), santa, & elves don’t exist. just because i don’t know what causes thunder doesn’t mean thor did it.

    profanity too much for you? give me a fucken break. request a site audit from your internet provider and publish it. let’s see how righteous you truly are.

  324. on 29 Mar 2013 at 11:59 pm 324.Anonymous said …


    In Darwin’s s day they once claimed infinite universe

    In those days they also believed in “fixed species”. And that, my friend, is one of the contributing reasons why we have The Theory of Evolution, as original explained by Mr Darwin.

    We should all cheer on the scientists and their incredible work. Looking forward to the Mars Curiosity rover’s latest findings.

    Slightly re-phrasing Biff’s comment, we get:
    Volcanoes; why should I believe they were created by nature? What in nature would suggest it is even possible? God is angry with us!!!!
    Different era, same thought process.

  325. on 30 Mar 2013 at 12:24 am 325.Anonymous said …


    When I look at DNA and the high information content, why should I believe it was created by nature? What in nature would suggest it is even possible

    In other words, I don’t understand.

    Look Grog. Ukk see fire in mountain. Sky Guardian unhappy with group. Sky Guardian make fire.
    In other words, I don’t understand.

  326. on 30 Mar 2013 at 2:25 am 326.DPK said …

    “When I look at DNA and the high information content, why should I believe it was created by nature?”

    Ok.. Fair enough I suppose. Since we currently do not have a thorough explanation, why should anyone assume there is a natural explanation?

    Well, lets look at the reality. We know for sure that life evolved here, and we know the natural world exists. So that is real. We also know that historically, every “mystery” which was thought to be the agency of supernatural gods has always turned out to have a natural, rather than a supernatural explanation. The rise and set of the sun, weather, storms, earthquakes, volcanos, droughts, diseases, crop failures… They all were once ascribed to gods, and now we know better.
    Next, lets look at the evidence that supernatural gods actually exist. Zero. None. Zip. That is why religious belief requires faith. Plus, there have been thousands of gods proclaimed and worshiped throughout history. Many natural phenomena have been ascribed to the action of these gods. They have all been completely, totally imaginary.

    So, why should you believe that DNA evolved through natural, rather than supernatural causes, even though the exact process is not yet fully understood? For the same reason you should believe that a star releases energy via fusion rather than a magical sun god riding a chariot of fire.

    Now, lets pose the question even simpler for you. Forget explaining exactly how the complexity of DNA evolved through natural causes… Just focus on this…… Why should we believe that a magical god, who you cannot even demonstrate actually exists, did it? And, IF you can do that, then tell us why we should believe that it was in fact YOUR particular god that did it, rather than some other god, or even an inter dimensional sea turtle?

  327. on 30 Mar 2013 at 2:54 am 327.Fluttershy said …

    i never thought of that, but if that doesnt make a theist think.
    all hope is lost.

  328. on 30 Mar 2013 at 3:24 am 328.The messenger said …

    Mr. 320.DPK, dark matter cannot be seen by us because it is only visible in a part of the light spectrum that we cannot see.
    Dark matter cannot be contain by any container made out of the elements that we know of.

  329. on 30 Mar 2013 at 3:51 am 329.Anonymous said …

    “i never thought of that, but if that doesnt make a theist think. all hope is lost.”

    For a theist it’s rarely about thinking but about how they *feel*. So, even whilst others are laughing at their ignorance and superstitions, the theists asinine beliefs make them feel all warm and fuzzy inside.

    That’s the part about religion that is stark raving bonkers mad. Anything else and the claim of an adult having an invisible best friend who was his own father and who sacrificed himself to himself to atone to himself would get you locked up for life in a mental hospital. Put the label religion on it and somehow those crazy people are allowed in the outside world so that they can rape little children and all the other shit the religious get away with in the name of their mental illness.

  330. on 30 Mar 2013 at 4:19 am 330.DPK said …

    Exactly… They seem unable to accept the fact that in science “we don’t know” is a perfectly acceptable and appropriate answer. The fact you don’t fully understand something does not then mean you get to just make shit up and demand others believe it.
    The process of claiming to know what is in fact, not known, is the province of religion, not science.
    Now, since this is a forum for discussing god and religion, and not the chemistry of DNA, can we recognize this as simply another attempt by Boz/Ben/biff/curm/Hor to distract attention from the fact that he has failed to answer every question posed of him, and more importantly, has utterly failed to provide any evidence that the god he wants everyone else to worship, actually exists.
    Until he does that, all the yammering about DNA is just a dog barking in the distance…. An unpleasant fart in the wind… Momentarialy unpleasant, but of little substance and gone with the next breeze.

  331. on 30 Mar 2013 at 3:47 pm 331.The messenger said …

    329.Anonymous, GOD made the universe, and if we study it, we must praise him.

  332. on 30 Mar 2013 at 4:03 pm 332.Anonymous said …

    On the subject of feeling, I have a friend who is feeling uncomfortable about her realization that her god doesn’t answer prayers. She is also uncomfortable about the amount of “evil” in the world.

    In order to reconcile her feelings with reality, she attended bible classes. Those classes made her feel worse because it was basically “shut up and believe”. She doesn’t want to discuss her feelings with her pastor because her pastor and her don’t agree on what it takes to get to heaven.

    So, what is she going to do? Try to come up with an explanation of why things are as they are?

    No. She’s currently church shopping. She doesn’t want to not believe in a god and baby Jesus nor does she want to give up the myth of heaven. Instead, she is going to various different churches to find one that believes in what she wants to believe.

    She’s not stupid, yet she can’t see how fucked up her thinking is. She claims to be “searching for answers”, yet the reality is she is trying to find someone who will tell her that the god that she wants to believe in exists and with all the rules and benefits that she wants to believe are true.

  333. on 30 Mar 2013 at 9:01 pm 333.A said …

    322 Biff,

    Seems the atheist cannot even answer why we should believe by faith that nature can write the program for DNA.

    Is it not incredible just how screwed up the atheist mind really is. That would not include the 21% of atheist who do believe in God. :)

  334. on 30 Mar 2013 at 9:40 pm 334.alex said …

    “Seems the atheist cannot even answer why we should believe by faith that nature can write the program for DNA.”

    if atheists cannot answer any of your questions, then your god must exist? is that it, you moron?

    “21% of atheist who do believe in God.”

    how many more times must your lie? is this the same as a theist who doesn’t believe in god?

    are you some kind of wannabee programmer?

    for(theist=0;theist<100;theist++){echo('theist is a liar');}

    how many times did the theist lie?

  335. on 30 Mar 2013 at 10:00 pm 335.The messenger said …

    331.Anonymous,Brother, GOD answers all prayers. Sometime he answers them in way that we do not expect. But he does answer all prayers. your friend seems to have little faith, perhaps you could allow me to contact her so that I could offer her some advice.

    I suggest that you tell me why she is loosing faith, so that I will know what advice to give her.

  336. on 30 Mar 2013 at 10:08 pm 336.The messenger said …

    331.Anonymous, priests and nuns of the Catholic Church are here to preach the gospel, and offer counsel to the troubled. Ask her to go to a Catholic church.

  337. on 31 Mar 2013 at 12:31 am 337.alex said …

    “Ask her to go to a Catholic church.”

    you dumbfuck, giving church advise on an atheist site? try a hindu or a moslem site next, you moron.

  338. on 31 Mar 2013 at 2:27 am 338.Anonymous said …

    “Ask her to go to a Catholic church.”

    How would being raped by a Catholic priest make things better?

  339. on 31 Mar 2013 at 2:54 am 339.The messenger said …

    337.alex, your stupidity infects you like canser to a human.

    Your arrogance will consume you, and you will feel regret.

  340. on 31 Mar 2013 at 3:16 am 340.The messenger said …

    338.Anonymous, any follower of GOD knows that lust is a sin. Therefore a real Catholic priest would never raped anyone.

    Only a godless human such as yourself would do something as disputable as rape.
    I pray on your behalf, for tomorrow he was resurrected on Easter Day.

  341. on 31 Mar 2013 at 3:19 am 341.The messenger said …

    Latest News
    updated 7:46 PM EDT 03.28.13
    Pope washes youths’ feet at detention center
    By Laura Smith-Spark, CNN

    A A A (resize font)
    (CNN) – Pope Francis washed the feet of a dozen prisoners, including young women, at a youth detention center in Rome as part of a Holy Thursday Mass ahead of Easter.

    The pontiff poured water over the young offenders’ feet, wiped them with a white towel and kissed them.

    The act of foot-washing at the Mass of the Lord’s Supper is part of the Christian tradition that mirrors Jesus’ washing of his disciples’ feet.

    Francis’ decision to celebrate the Mass with young offenders at the Casal del Marmo center represents a break with tradition but is in step with his record in embracing simplicity and humility.

    Read: Pope Francis to shun luxury papal apartment

    The service has in past years been held at the grand Basilica of St. John Lateran, the official seat of the bishop of Rome.

    This time, the Mass “will be, by his express desire, very simple,” the Vatican said before the service.

    The young offenders were expected to give the pope a wooden crucifix and kneeler, which they made themselves in the detention center’s workshop.

    In return, Francis was to bring Easter eggs and colomba, traditional Italian Easter cake in the shape of a dove, for all, the Vatican had said.

    The Casal del Marmo center houses close to 50 inmates, who range in age from 14 to 21. The young people who had their feet washed were chosen from different nationalities and diverse religious backgrounds. Two young women and two Muslims were included in the rite, according to the Vatican.

    Journalist Livia Borghese contributed to this report.
    1 2 3
    CNN Home Full Article

    Email »
    From the Web
    25 Most Breathtaking National Geographic Photographs (Daily Fun Lists)
    10 Impressive Tattoos (PHOTO GALLERY] (DexKnows)
    10 Common Weight Loss, Nutrition, & Diet Myths (ActiveBeat)
    And so it Goes (AARP)
    More from CNN
    Pope’s sister prayed he wouldn’t be picked; now she’s proud, from afar
    Pope Francis to shun luxury papal apartment, for now
    Brazilian doctor killed 7 patients to free up hospital beds, police say
    A grisly crime surges into spotlight as Mexico shifts drug war strategy
    [What’s this?]
    Related Videos
    Pope Francis to wash feet of prisoners
    Pope Francis rejects papal apartment
    Priests hope to clear Pope Francis’ name

  342. on 31 Mar 2013 at 3:35 am 342.The messenger said …

    Athiests such as christifer Hitchens, and Alex, take pleasure in condemning the kind people of this world, such as mother teresia. Mother teresia gave millions of dollars to the people of India so that they could find their way out of poverty and distress.

    But Christofer Hitchens took pleasure in spreading lies and unproved rummers, such as secret baptisms and favoring the Indian people. Mother teresia never favored any one race of people; she loved them all equally. She gave hope and financial support to those in need for it, and she taught people how to be kind again.

    Kindness is a trait that have obviously aluted Mr. Hitchens. He would rather focus on his own wealth and the alcohol that he treasured so much in life.

    Christofer was also an enemy of democracy. He believes that the government should rule over us. He fails to realize that citizens rule the government, the government will never rule us.

  343. on 31 Mar 2013 at 2:25 pm 343.Anonymous said …

    From “A”, the learned Astrophysicist, we get:

    That would not include the 21% of atheist who do believe in God

    In other Pew survey polls it was found that 23% of virgins have had sex and 35% of dead people are alive. Surprisingly, only 15% of lesbians are attracted to men.

  344. on 31 Mar 2013 at 5:38 pm 344.DPK said …

    Hahaha… Yeah, he is an idiot, inst he?
    I just did my own informal poll. I asked 50 random people coming out of church this morning if they believed in Zeuss. ALL of them said, “no.”
    So there you have it. 100% of theists questioned denied belief in god!
    So can we now say that surveys indicate that virtually all theists do not believe in god?
    As ass man would say, “redefining terms, like gay marriage”.
    I forgot to ask him before when her said that, what he thought “gay marriage” means now that it has been redefined?

  345. on 31 Mar 2013 at 5:39 pm 345.Fluttershy said …

    14% of sprinters cannot run.
    34% of soldiers cant fight.

  346. on 31 Mar 2013 at 5:53 pm 346.Anonymous said …

    100% of polls and surveys found on the internet are 100% accurate.

  347. on 31 Mar 2013 at 6:28 pm 347.DPK said …

    on 30 Mar 2013 at 3:24 am 328.The messenger said …
    Mr. 320.DPK, dark matter cannot be seen by us because it is only visible in a part of the light spectrum that we cannot see.
    Dark matter cannot be contain by any container made out of the elements that we know of.

    Sigh… You really haven’t got a clue have you?
    You are too dim to even realize you don’t have the slightest idea of what we are talking about. Go away, you useless troll.

  348. on 31 Mar 2013 at 6:32 pm 348.Biff said …

    Professing atheist believing in God only means they are now honest.

    But rather than insults and diversions will any atheist answer why we should believe in faith that nature can write DNA code? If no God exists, that is the only answer, yes?

    Why are the atheists so scared?

  349. on 31 Mar 2013 at 7:17 pm 349.Anonymous said …

    “Why are the atheists so scared?”

    anything more scary than everlasting torment? why ain’t i scared? because like the nonstop bullshit the theists keep dropping in here, surely i’ll get used to the hellish torment after a couple of thousand years?

    seriously, as a homeless bum, i found a gift outside my tent and for the life of me, i cannot answer the question of where the gift came from. is it god?

    my cousin, the african bushman, had the same question. him and his homies were starving and a damn gnu ran into a tree and killed itself thereby providing a big feast. i told him it was the xtian god’s work. he cursed me with those clickety clackety words.

    fucken bushman going to hell.

  350. on 31 Mar 2013 at 7:23 pm 350.alex said …

    oops. damn new windoze 8 computer. 345 be me.

  351. on 31 Mar 2013 at 7:40 pm 351.Anonymous said …


    answer why we should believe in faith that nature can write DNA code?

    We should apply logic and reasoning. Faith means accepting goddidit. Shall we try and see where we get with what we know today?
    Prediction: There goes Biffy, running away again now that we try and apply thought to the issue. Blind faith will only carry you so far, especially when you objectively search for real answers.

    For instance, speaking of objective and commonly understood facts, let’s agree that the first lifeforms on Earth emerged BILLIONS of years ago and were simple single celled organisms. No humans, gazelles, or, earthworms at that time.

    Let’s also agree that the issue of “fixed species” was taken care of with the Theory of Evolution.

  352. on 31 Mar 2013 at 7:40 pm 352.The messenger said …

    347.DPK, the information that I stated about the nature of dark matter is completely true.

    It was told to me by one of my friends who happens to by a theoretical physicist.

  353. on 31 Mar 2013 at 7:56 pm 353.The messenger said …

    347.DPK, if my answer is false then please tell me the true nature of dark matter.

    When dark matter collides with the elements that are visible to us, it imedeanity vaporizes its self and the atom that it collided with. Dark matter is admited from our sun, and from dead stars.

  354. on 31 Mar 2013 at 11:08 pm 354.DPK said …

    Go back and read the posts again William.. And try to concentrate. Here’s a clue, it isn’t about dark matter at all.

    Now, since you brought it up, it is obvious your “friend” is not a theorietical physicist, or you just made that up. Why do you always have to lie about things to try and make people believe you? That’s a sign of a serious mental illness.

  355. on 01 Apr 2013 at 2:18 am 355.The messenger said …

    354.DPK, you asked a question that you thought a man of faith could not answer.

    I proved you wrong three times now.

    First, by giving the correct answer to your dark matter question.

    Second, after you failed to provide an answer to the dark matter question that would contradict mine.

    Third, you stated that I either made up my friend, or he is not a theoretical physisist.

    I promise, in the name of GOD, our father in heaven, that I do not lie on this site.
    I only preach the word of The Lord, the truth.

  356. on 01 Apr 2013 at 2:31 am 356.The messenger said …

    Read this, brothers.

    The Rage Against God
    The Rage Against God

    Front cover of the UK edition
    Author(s) Peter Hitchens
    Country United Kingdom
    Language English
    Subject(s) Religion, autobiography
    Genre(s) Apologetics
    Publisher Continuum (UK); Zondervan (US)
    Publication date 15 March 2010 (UK); 1 May 2010 (US)
    Pages 256
    ISBN 1-4411-0572-7 (UK); 0310320313 (US)
    Preceded by The Broken Compass
    The Rage Against God (subtitle in US editions: How Atheism Led Me to Faith) is the fifth book by Peter Hitchens, first published in 2010. The book describes Hitchens’s journey from the militant atheism of the far political left and bohemianism to Christianity, detailing the influences on him that led to his conversion. The book is partly intended as a response to God Is Not Great, a book written by his brother Christopher Hitchens in 2007.

    Peter Hitchens, with particular reference to events which occurred in the Soviet Union, argues that his brother’s verdict on religion is misguided, and that faith in God is both a safeguard against the collapse of civilisation into moral chaos and the best antidote to what he views as the dangerous idea of earthly perfection through utopianism. The Rage Against God received a mostly favourable reception in the media. Hitchens was praised for making a forceful and intelligent case, in particular with respect to questions concerning morality and God. Some critics contended that the author was misguided in drawing a link between state atheism and totalitarianism.



    Part One: A Personal Journey Through Atheism

    In the book Hitchens describes how the painting The Last Judgement played a significant part in his conversion to Christianity.
    In Chapter 1 Hitchens describes abandoning religion in his youth, and promoting “cruel revolutionary rubbish” as a Trotskyist activist.[4] He claims his generation had become intellectually aloof from religion, rebellious and disillusioned[5] and in Chapter 2 explores further reasons for this disillusion, including the Suez Crisis and the Profumo Affair.[6] In Chapter 3, Hitchens recounts how he embraced scientific inquiry and adopted liberal positions on issues such as marriage, abortion, homosexuality, and patriotism.[7] Chapter 4 is a lament for the “noble austerity”[8] of his childhood in Britain. Chapter 5 explores what Hitchens views as the pseudo-religion surrounding Churchill and World War II heroes – a “great cult of noble, patriotic death”[9] whose only equivalent, he claims, was in the Soviet Union.[10] Hitchens then asserts that, “The Christian Church has been powerfully damaged by letting itself be confused with love of country and the making of great wars”.[11] In Chapter 6 Hitchens recalls being a foreign correspondent in the Soviet Union and a trip to Mogadishu, and how these experiences convinced him that, “his own civilisation was infinitely precious and utterly vulnerable”.[12] In Chapter 7 Hitchens charts his return to Christianity, and makes particular reference to the experience of seeing the Rogier van der Weyden painting The Last Judgement:[4] “I gaped, my mouth actually hanging open. These people did not appear remote or from the ancient past; they were my own generation … I had absolutely no doubt I was among the damned”.[4] In Chapter 8 Hitchens examines the diminishing of Christianity in Britain and its potential causes.[13][14]

    Part Two: Addressing Atheism: Three Failed Arguments

    In the book Hitchens cites atrocities committed under the Khmer Rouge as an example of crimes against humanity perpetrated by atheist states (skulls of victims shown).
    In Chapter 9, Hitchens contends that the claim that religion is a source of conflict is a “cruel factual misunderstanding”,[15] and that a number of conflicts, including The Troubles and the Arab–Israeli conflict, were not motivated by religion but tribal in nature and disputes over territory.[16] Chapter 10 discusses whether morality can be determined without the concept of God. Hitchens asserts that atheists “have a fundamental inability to concede that to be effectively absolute, a moral code needs to be beyond human power to alter”.[17] He also describes as flawed his brother’s assertion in God is Not Great that “the order to love thy neighbour ‘as thyself’ is too extreme and too strenuous to be obeyed”.[6][18] Hitchens ends the chapter by stating, “in all my experience in life, I have seldom seen a more powerful argument for the fallen nature of man, and his inability to achieve perfection, than those countries in which man sets himself up to replace God with the State”.[19] Hitchens begins Chapter 11 by asserting, “those who reject God’s absolute authority, preferring their own, are far more ready to persecute than Christians have been … Each revolutionary generation reliably repeats the savagery”.[20] He cites as examples the French revolutionary terror; the Bolshevik revolution; the Holodomor and the Soviet famine of 1932–33; the barbarity surrounding Joseph Stalin’s five-year plans, repeated in the Great Leap Forward in China; atrocities committed by the Khmer Rouge; and human rights abuses in Cuba under Fidel Castro. Hitchens then quotes a number of prominent communist thinkers’ pronouncements on morality, including George Lukacs stating, “Communist ethics make it the highest duty to accept the necessity of acting wickedly. This is the greatest sacrifice the revolution asks from us”, and Leon Trotsky’s claiming that “morality, more than any other form of ideology, has a class character”.[21][22]

    Part Three: The League of the Militant Godless

    Demolition of the Cathedral of Christ the Saviour in Moscow. In the book Hitchens details various attempts by the Bolshevik regime to expunge religion from Soviet society.
    Hitchens writes “the biggest fake miracle staged in human history was the claim that the Soviet Union was a new civilisation of equality, peace, love, truth, science and progress. Everyone knows that it was a prison, a slum, a return to primitive barbarism, a kingdom of lies where scientists and doctors feared offending the secret police, and that its elite were corrupt and lived in secret luxury”.[23] He then cites Walter Duranty’s denying the existence of the great Ukrainian famine,[24] and Sidney and Beatrice Webb’s acceptance that the 1937 Moscow show trials were “genuine criminal prosecutions”.[24] Hitchens then examines Lenin’s suppression of religion in the Soviet Union, which included making the teaching of religion to children punishable by the death penalty and the creation of an antireligious organisation of Soviet workers. Hitchens begins Chapter 13 by quoting William Henry Chamberlin: “In Russia, the world is witnessing the first effort to destroy completely any belief in supernatural interpretation of life”,[25][26] and then examines some consequences of this, including intolerance of religion, terror, and the persecution of priests and bishops at the Solovetsky concentration camp. Hitchens asserts that in the Soviet Union “the regime’s institutional loathing for the teaching of religion, and its desire to eradicate it, survived every doctrinal detour and swerve”.[27] In the final chapter, Hitchens analyses a number of his brother’s arguments, and contends that “the coincidence in instinct, taste, and thought between my brother and the Bolsheviks and their sympathisers is striking and undeniable”.[28] He then records how his brother nominated the “apostle of revolutionary terror”[28] Leon Trotsky for an edition of the BBC radio series Great Lives;[29] praised Trotsky for his “moral courage”;[28][30] and declared that one of Lenin’s great achievements was “to create a secular Russia”.[28][31] Hitchens speculates that his brother remained sympathetic towards Bolshevism and is still hostile towards the things it extirpated, including monarchy, tradition, and faith.[32] He ends the chapter by claiming a form of militant secularism is becoming established in Britain, and that “The Rage Against God is loose”.[33]


    In the epilogue, Hitchens describes how after a 2008 debate with Christopher Hitchens “the longest quarrel of my life seemed to be unexpectedly over”[34] and that he held no hope of converting his brother, who had “bricked himself up high in his atheist tower, with slits instead of windows from which to shoot arrows at the faithful”.[35]

    HideCritical reception

    After its UK publication in March 2010 the book received a number of mostly favourable reviews in British newspapers.

    In The Daily Telegraph Christopher Howse concentrated on the moral arguments in the book, and agreed with Hitchens that “to determine what is right and what is wrong without God, is difficult”.[36] Also in The Daily Telegraph, Charles Moore wrote that the book “tries to do two things at once. One is to bash up modern militant atheism with all the author’s polemical skill. The other is to give an autobiographical account of how, in our time, an intelligent man’s faith may recover”.[37] In a positive review in Standpoint magazine, Michael Nazir Ali wrote, “One of the abiding canards nailed by Peter Hitchens is that religion causes conflict. He does this by showing that so-called “religious” wars had many other elements to them, such as greed for territory, political ambition and nationalism. His repeated references to Soviet brutality reveal that secular ideologies have caused more suffering in recent times than any conflict associated with religion.”[38] In a more critical review in The New Statesman Sholto Byrnes wrote, “Hitchens makes his case forcefully, passionately and intelligently”, but “makes too much connection between the ill deeds of atheists and their atheism”.[39] Byrnes also reviewed the book in The Independent, where he questioned the validity of a number of Hitchens’s conclusions, including that “atheists ‘actively wish for disorder and meaninglessness'”.[40] In a sympathetic review in The Guardian, Rupert Shortt wrote, “Hitchens does not seek to mount a comprehensive defence of Christianity. He is wise to avoid deeper philosophical and theological waters, because his strengths lie elsewhere. His more manageable aim is to expose what he holds to be three major fallacies underlying God Is Not Great: that conflict fought in the name of religion is really always about faith; that “it is ultimately possible to know with confidence what is right and what is wrong without acknowledging the existence of God”; and that “atheist states are not actually atheist”.[41] In The Spectator, Quentin Letts reviewed the book very positively, describing it as “a magnificent, sustained cry against the aggressive secularism taking control of our weakened culture”.[42]

    Reviews of the book in North American publications subsequent to its stateside release were more mixed.

    In The New York Times, Mark Oppenheimer commented, “American readers will notice a lack of enthusiasm in Peter’s Christian apologetics. He proceeds largely from historical, rather than personal, evidence: here are the fruits of Christianity, and here is what one finds in its absence”.[43] In a negative review in the Winnipeg Free Press, Ted St. Godard wrote, “What Hitchens can’t seem to appreciate is that, even if ‘Soviet Communism is organically linked to atheism, something his brother and others argue against (if somewhat feebly), and even if one accepts that Soviet tyranny was horrible, this says little about the existence of God”.[44] In a The Washington Times review entitled “Cain and Abel: The sequel?”, Jeremy Lott wrote, “Hitchens refuses to make a full-throated case for faith. He explains that ‘those who choose to argue in prose… are unlikely to be receptive to a case that is most effectively couched in poetry’ … Peter does hope that Christopher might one day arrive at some sort of acceptance that belief in God is not necessarily a character fault—and that religion does not poison everything”.[45]

    ShowRelease details

    ShowSee also



    ShowExternal links

    ShowRead in another language

    Last modified 15 days ago

  357. on 01 Apr 2013 at 3:01 am 357.The messenger said …

    on 01 Apr 2013 at 2:18 am 355.The messenger said … Your comment is awaiting moderation.
    354.DPK, you asked a question that you thought a man of faith could not answer.
    I proved you wrong three times now.
    First, by giving the correct answer to your dark matter question.
    Second, after you failed to provide an answer to the dark matter question that would contradict mine.
    Third, you stated that I either made up my friend, or he is not a theoretical physisist.
    I promise, in the name of GOD, our father in heaven, that I do not lie on this site.
    I only preach the word of The Lord, the truth.

  358. on 01 Apr 2013 at 3:17 am 358.The messenger said …

    354.DPK, I know why you asked the dark matter question.

    You thought that you could make us seem unintelligent for not answering.

    So therefore, I provided an answer to your question as a way to show you that we theist are more inteligent than any Athiest.

    We posses know lage of science, and a knowlage greater than science. We posses the knowlage of love, peace, kindness, humility, and forgiveness. These virtues have eluted atheist.

  359. on 01 Apr 2013 at 3:20 am 359.The messenger said …

    354.DPK, I know why you asked the dark matter question.
    You thought that you could make us seem unintelligent for not answering.
    So therefore, I provided an answer to your question as a way to show you that we theists are more inteligent than any Athiest.
    We posses knowledge of science, and a knowledge greater than science. We posses the knowledge of love, peace, kindness, humility, and forgiveness. These virtues have eluted atheists.

  360. on 01 Apr 2013 at 4:21 am 360.Anonymous said …

    Messenger has a friend who is a physicist in the same way that “A” is an Astrophysicist and that A, Lou, Curmudgeon, Martin, Xenon, Biff, Ben and friends answer questions.

    It’s also the same version of “completely true” that Messenger uses when he claims to be a Catholic.

  361. on 01 Apr 2013 at 4:28 am 361.Fluttershy said …

    347.DPK, if my answer is false then please tell me the true nature of dark matter.
    When dark matter collides with the elements that are visible to us, it imedeanity vaporizes its self and the atom that it collided with. Dark matter is admited from our sun, and from dead stars.

    Darkmatter is COMPLETELY different.

  362. on 01 Apr 2013 at 12:53 pm 362.Biff said …


    Why we should believe in faith that nature can write DNA code? If no God exists, then it must be a natural process, right?

    You will need to explain what you believe happened, how it happened, when it happened, and provide verifiable details. Please provide citations so that we can independently read your submission.

  363. on 01 Apr 2013 at 12:55 pm 363.DPK said …

    Shhh.. Don’t give him any help. It’s fun watching him scramble. His “friend”, the theorietical physicist, is named Mr. Google.
    Messenger has long had a propensity to lie in order to further his propaganda. Remember when he first came here he claimed that he had personally been to heaven and spoken with god?

  364. on 01 Apr 2013 at 12:56 pm 364.Biff said …

    “Why do you always have to lie about things to try and make people believe you?”

    Why is lying wrong DPK? I believe it was you who once made the claim lying was OK in the right situation?

  365. on 01 Apr 2013 at 1:08 pm 365.The messenger said …

    361.Fluttershy, the fact that you have once again failed to provide an answer to the nature of dark matter question, and due to the fact that you try to contradict my answer by just stating that it is false, is proof that you have absolutely no idea what you are talking about.

    If dark matter is completely different than antimatter, please explain to us why they are different.

  366. on 01 Apr 2013 at 1:12 pm 366.The messenger said …

    363.DPK, we all speak to GOD, whether it be directly or indirectly.

    He gives us signs of what is right and what is wrong, that is how he communicates with us.

  367. on 01 Apr 2013 at 1:32 pm 367.Anonymous said …


    Why we should believe in faith that nature can write DNA code? If no God exists, then it must be a natural process, right?

    Why don’t you re-read post #351 above? Perhaps an avenue you want to avoid?
    Believers keep on believing, thinkers keep on thinking. Never the twain shall meet.

  368. on 01 Apr 2013 at 1:37 pm 368.Anonymous said …


    I believe it was you who once made the claim lying was OK in the right situation?

    But, Biffy-boy, you’re a xtian. Oh wait…lying is an integral part of that package. Lie to those around you and lie to yourself. We all know that. And you’re a pro at it.

  369. on 01 Apr 2013 at 3:39 pm 369.Fluttershy said …

    Biff said
    Why we should believe in faith that nature can write DNA code? If no God exists, then it must be a natural process, right?
    You will need to explain what you believe happened, how it happened, when it happened, and provide verifiable details. Please provide citations so that we can independently read your submission.

    As said multiple times by different people, this blog is about god, not evolution, not antimatter, not santa clause, not jeffry the magical giant squid, and not DNA.

    So would you kindly tell US about god and explain what you believe happened, how it happened, when it happened, and provide verifiable details.
    *sigh* of course you are unable to do so…

  370. on 01 Apr 2013 at 5:04 pm 370.DPK said …

    359.Biff said …

    “Why is lying wrong DPK? I believe it was you who once made the claim lying was OK in the right situation?”

    Indeed it is there Biffy? I take it you disagree?
    So, when the Nazi stormtroopers are at the door, Jesus wants you to say “I cannot lie, Mr. Nazi… Yes, the Jews are hiding in the basement!”

    Well, so much for your absolute moral code that prohibits lying. Oops.

  371. on 01 Apr 2013 at 5:09 pm 371.DPK said …

    And I assume Biff is now saying it is ok for messenger to lie about shit as long as it benefit the spread of his religious beliefs. What kind of god do you all believe in that you have to lie to people to get them to believe it? Seems if he was real you could convince people with the truth, rather than having to always make up lies and be endless trying to explain away problems. Not much of a god you’re working for there dude.
    Biff… are you off your meds again? Maybe too many chocolate eggs from the holy bunny yesterday? Or maybe the Holy Ghost just filled you with the spirit and told you it’s ok to lie for Ja-heez-hus!

  372. on 01 Apr 2013 at 6:16 pm 372.Biff said …

    “As said multiple times by different people, this blog is about god,”

    That is a claim made by posters who are cowards, not Thomas. Actually this blog is about just anything Thomas would like to post. Politics, Morality, Messenger lying, Sock puppets,Magical Turtles, etc. However, origins and creation tie into God and if you claim there is no God, you have quite the task explaining how DNA was programmed. What you are saying is that nature can write programs.

    So Flutter, where is an answer. Must I believe in faith nature created DNA? Stop with the excuses.


    “Indeed it is there Biffy?”

    Is that a question?????? Well, I don’t know if he lied but if he did why do you have a problem? You don’t agree with when he chose to lie? What are the guidelines for lying properly DPK?

    I like Biffy, sort of rings with spiffy. Thanks boys.

  373. on 01 Apr 2013 at 7:02 pm 373.Anonymous said …

    I like Biffy, sort of rings with spiffy.

    bif·fy (bf) also biff (bf)
    n. pl. bif·fies also biffs Upper Midwest
    1. An outdoor toilet; an outhouse.
    2. An indoor toilet.

    Works for me!

    Now let’s examine the trail which leads to your assumption.

    you have quite the task explaining how DNA was programmed. What you are saying is that nature can write programs.

    Re-read and answer Post #351, please. Stun the audience with your revelation of some (or any) god’s existence.

  374. on 01 Apr 2013 at 7:26 pm 374.DPK said …

    Yes Biffy… the guidelines for when it is moral to lie and when it is not come from something called ethics, which is not absolute. I take your admission means you would have turned in the postulated jews in the basement rather than lie and violate the absolute biblical moral code. Sad.

    ““Indeed it is there Biffy?”

    Is that a question??????”

    Tragically, rather than answer, you choose to focus on a punctuation error. That’s telling.

    “if you claim there is no God, you have quite the task explaining how DNA was programmed.”

    No, we don’t. We know DNA exists, we know nature exists, and we know nature behaves according to natural laws. This is undeniable. So, anything that exists in nature is by definition “natural”. No proof is required.

    You, on the other, are claiming there is a super-natural cause. Therefore, YOU have quite the task of demonstrating that such a thing exists and that such a thing actually interacted with the physical world to do so. Good luck with that. The fact that you are too dim to imagine any other possibility doesn’t count as “evidence” otherwise there would be sufficient evidence that Thor hurls lightning bolts from his chariot of thunder. I know you hate the analogy, but that is only because you have no answer for it, likely because it is absolutely true.

    So, once again Biffy… time to put up or shut up. Based on past experience with you, you’ll be gone a while. See ya.

  375. on 01 Apr 2013 at 8:22 pm 375.Biff said …

    “Tragically, rather than answer, you choose to focus on a punctuation error. That’s telling.”

    Is it DPK? I didn’t know what you were attempting to get across. Probably more evasion, ignoring of the question and childish rants. But let us examine your attempt at, an answer?

    “No, we don’t. We know DNA exists, we know nature exists, and we know nature behaves according to natural laws. This is undeniable.”

    This is well deserving of a duh!

    Nature behaves in accordance with natural law! Hey my laptop behaves like a laptop! Thank you Albert. What natural law programmed DNA? Let is assume God did not do it. Notice I am not making a God claim, as you like to allude to. I am asking you how did it happen?


    Again you do not offer guidelines for lying. Your assumption without proof Messenger lied has outraged you? Why? When is it OK to lie?

  376. on 01 Apr 2013 at 8:50 pm 376.DPK said …

    “What natural law programmed DNA? Let is assume God did not do it. Notice I am not making a God claim, as you like to allude to. I am asking you how did it happen?”

    And as I have told you many times before… I don’t know.
    Newsflash Biffy… neither do you.
    So what?

    I also don’t know how gravity hold planets in orbit around the sun. That doesn’t mean angels hold it in place by flapping their wings.

    Do you have a point here, other than your bullheaded clinging to your tired argument from ignorance. No one here is claiming to know the exact process by which DNA evolved over thousands of millions of years. What exactly do you think that then proves there Biffer?

  377. on 01 Apr 2013 at 9:35 pm 377.Biff said …

    “And as I have told you many times before… I don’t know.”

    Well, I think you believe you do. You have eliminated a programmer. Therefore, you have accepted that is must be natural and that nature can somehow write the complex code of DNA. Yes? So nature must have done it, Right?

  378. on 01 Apr 2013 at 9:37 pm 378.Biff said …

    “And as I have told you many times before… I don’t know.”

    Well, I think you believe you do. You have eliminated a programmer. Therefore, you have accepted that is must be natural and that nature can somehow write the complex code of DNA. Yes? So nature must have done it, Right?

  379. on 01 Apr 2013 at 10:01 pm 379.Anonymous said …


    Therefore, you have accepted that is must be natural and that nature can somehow write the complex code of DNA. Yes? So nature must have done it, Right?

    Can we agree that nobody knows exactly how it all began?

    no entirely plausible hypothesis for the spontaneous origin of life has been found. But this does not mean that supernatural activity is the only possible explanation.

    A simple response would be to give a God-of-the-gaps explanation: that some supernatural force, namely God, must have intervened to bring life into being.
    From: http://biologos.org/questions/the-origin-of-life

    On faith, you claim a god. Should we attempt to apply logic and reason and see what makes the most sense? Are you ready, Biffy, for that exercise?

  380. on 01 Apr 2013 at 10:15 pm 380.alex said …

    “You have eliminated a programmer. Therefore, you have accepted that is must be natural and that nature can somehow write the complex code of DNA. Yes? So nature must have done it, Right?”

    wrong. he might have eliminated a programmer, but i’ll add santa to your bullshit, elimination list. after your god, plenty of room for more.

    you refuse the “i don’t know”, but you insist on knowing the answer. stop the runaround and provide the proof for your god, who is labeled bullcrap until you have proven otherwise.

    remember dpk’s turtle, whom you readily dismissed? of course, the turtle has no proof and you are right in dismissing it. bullshit turtle & bullshit god, both equally dismissed.

  381. on 01 Apr 2013 at 10:21 pm 381.DPK said …

    I have absolutely not eliminated a programer.
    Why do you have to lie about what I said in order to try and make your point?
    I said, “I don’t know.” What does that mean? It means I don’t know.
    What I do know is there is plenty of evidence that natural laws exist and they can do amazing things. I also know that lots and lots of other stuff that has, in the past, been declared to be the province of the supernatural by ignoramuses, like you have always had a non-supernatural explanation. I also know that neither you, nor anyone else here has provided even one shred of credible evidence that the supernatural god that you claim as a programer actually exists.

    So therefore, I think it far more likely that there is also a natural explanation for the evolution of information in DNA than there is that it was programed by a supernatural force, of which there is ZERO evidence.

    Now, here is a structure that appears to be designed. It is complex and information rich. Who programed it?

  382. on 01 Apr 2013 at 11:03 pm 382.DPK said …

    I have absolutely not eliminated a programer. I don’t pretend to know thing that I do not know.

    Why do you have to lie about what I said in order to try and make your point?

    I said, “I don’t know.” What does that mean? It means I don’t know. Neither do you.

    What I do know is there is plenty of evidence that natural laws exist and they can do amazing things. I also know that lots and lots of other stuff that has, in the past, been declared to be the province of the supernatural by ignoramuses, like you, have ALWAYS had a non-supernatural explanation.

    I also know that neither you, nor anyone else here has provided even one shred of credible evidence that the supernatural god that you imply as a programer actually exists.

    So therefore, I think it far more likely that there is also a natural explanation for the evolution of information in DNA than there is that it was programed by a supernatural force, of which there is ZERO evidence. Unless you have any actual evidence to the contrary, your endless yammering is really tiresome and completely pointless.

    How about it Biffy, do YOU care to give us an explaination about where the information in DNA came from, specifically?

    I’ll give you an even easier task to start… good natured fellow that I am. A sand dune is complex, appears “designed” and contains lots and lots of information in its structure… who programed it?

  383. on 02 Apr 2013 at 2:42 am 383.fluttershy said …

    “Well, I think you believe you do. You have eliminated a programmer. Therefore, you have accepted that is must be natural and that nature can somehow write the complex code of DNA. Yes? So nature must have done it, Right?”

    Well, in MY opinion, being that every thing is consisted of atoms, it is not impossible, that in sheer chance and randomness, that enough combined to form a single cell.
    However, not every one believes in this, just to warn you…

    One thing i can, without fear of actual retaliation, say is that a “God” did not form ANYTHING in this universe, ever.

  384. on 02 Apr 2013 at 12:08 pm 384.Biff said …

    “I have absolutely not eliminated a programer.
    Why do you have to lie about what I said in order to try and make your point?
    I said, “I don’t know.””

    I don’t lie, you and others have stated repeatedly there in no God on this blog. However, so you are agnostic not an atheist? or would you be one of the 23% of atheists who responded they believe in God?

    Or, would you being putting you faith in nature having the ability to write multiple high information coding? Your faith in the propability of nature is based on what?

    How can we place out faith in nature when is shows absolutely no ability whatsoever to perform such a task?

  385. on 02 Apr 2013 at 12:14 pm 385.Biff said …

    “I have absolutely not eliminated a programer.
    Why do you have to lie about what I said in order to try and make your point?
    I said, “I don’t know.””

    I don’t lie, you and others have stated repeatedly there in no God on this blog. Fluttershy seems pretty sure right above this post. However, so you are agnostic not an atheist? or would you be one of the 23% of atheists who responded they believe in God?

    Or, would you being putting you faith in nature having the ability to write multiple high information coding? Your faith in the probability of nature is based on what?

    How can we place out faith in nature when is shows absolutely no ability whatsoever to perform such a task?


    “Well, in MY opinion, being that every thing is consisted of atoms, it is not impossible, that in sheer chance and randomness, that enough combined to form a single cell.”

    Astonishing, Fluttershy can you provide for us a step by step process for how this would happen? Please provide citations so that we can properly review your work.

  386. on 02 Apr 2013 at 12:22 pm 386.Fluttershy said …

    as i said…that is my opinion.
    physically and biologically it is possible, however unlikely.

  387. on 02 Apr 2013 at 12:24 pm 387.Fluttershy said …

    i think its called abiogenesis or something, not heaps sure, but i understand atoms and biology enough to make sense of it.

  388. on 02 Apr 2013 at 12:29 pm 388.Fluttershy said …

    Being that i have answered you question fairly and with enough words for you to do some R/D.
    may you please say how exactly your god made the earth and everything else?

  389. on 02 Apr 2013 at 12:37 pm 389.DPK said …

    Biff you are so dense. As has been said her repeatedly, show us your god and we will believe. What has been said is, we do not believe your god is real, because there is no evidence to suggest he is real. I do not believe your claim, just as you do not believe Zeuss an Apollo are real. Why do you not believe in them biff? Are you one of the mono theists that believe in more than one god, or are you simply agnostic when it comes to Zeuss and Thor and the other gods you don’t believe in.

    You claim nature shows no ability to assemble complexity from simplicity? Are you blind, or stupid? Well, we know the answer there, you’re not blind.

  390. on 02 Apr 2013 at 12:50 pm 390.DPK said …

    And biff, you against dodged my question. I always answer our questions, you always dodge mine. Where did the information in the sand dunes come from?
    When light travels from a distant star, it contains information about the nature of the star. Who programmed it? A geological core sample contains information about conditions in the past. How did the information get there? When two atoms of hydrogen react with one atom of oxygen to form a water molecule, is that directed by someone?

  391. on 02 Apr 2013 at 1:22 pm 391.Anonymous said …


    nature having the ability to write multiple high information coding? Your faith in the probability of nature is based on what?

    Pssst, Hor, err, I mean Biffy…”Pillars of Creation”. Google it!!! Gas, dust, and gravity (aka Natural Elements and Forces). Poof a new star is born. Fucking magic, I don’t understand it either.
    We can observe the events with our own eyes, Nature in action. Faith is saying goddidit, ain’t it?

  392. on 02 Apr 2013 at 2:01 pm 392.Fluttershy said …

    Being that i have answered you question fairly and with enough words for you to do some R/D.
    may you please say how exactly your god made the earth and everything else?

    Please every athiest here, keep this here and await a response.

  393. on 02 Apr 2013 at 2:34 pm 393.DPK said …

    Let me pose another question for you to ignore there A-Biff… (I wish you’d choose just one of your personalities, its tiresome keeping track of which sock you are pretending to be today).

    Do you believe that time is eternal? I assume that you believe in the “standard” definition of god, that he is eternal and has existed for an infinite time? In that case, there must have been a time “before” the big bang yes? In fact, there must have been an infinite amount of time before the big bang… would you agree? Don’t be afraid there Biff… you either do, or you don’t… just tell us, if you want, you can answer all the other direct questions posed of you first. But, I predict you will either ignore them and refuse to answer, or you will disappear and magically reappear as Ben, or Boz, or Hor, or ASS and try to change the subject.
    Let’s take at look at all the direct question you have refused to answer… just n recent days:

    You cannot explain the nature of dark matter and dark energy. Why then do you not believe in the inter-dimensional sea turtle, which explains it perfectly?

    Why do you accept Yahweh as the creator god, and not Allah or some other creator god? You must have a reason to pick one over thousands of others?

    Why do you continue to assert that anyone educated in life sciences would “naturally assume” that organic chemistry would require an “Intelligent agent” when the simple fact is that the overwhelming majority of those highly educated people in fact believe exactly the opposite? Do you have a reason for this?

    Volcanoes; why should we believe they were created by nature? What in nature would suggest it is even possible?

    Why should we believe that a magical god, who you cannot even demonstrate actually exists, did it (bio-genesis)? And, IF you can do that, then tell us why we should believe that it was in fact YOUR particular god that did it, rather than some other god, or even an inter dimensional sea turtle?

    What is YOUR definition of “atheist”? (Since it obviously does not agree with the rest of the world’s understanding of what it means).

    What do you think “gay marriage” means, now that it has been “redefined”? (Not sure if you, or other you made this idiotic claim… either of you can answer)

    When the Nazi stormtroopers are at the door, Jesus wants you to say “I cannot lie, Mr. Nazi… Yes, the Jews are hiding in the basement!”, correct Biff? If not, how do you know?

    How about it Biffy, do YOU care to give us an explanation about where the information in DNA came from, specifically?

    A sand dune is complex, appears “designed” and contains lots and lots of information in its structure… who programed it?

    When light travels from a distant star, it contains information about the nature of the star. Who programmed it? A geological core sample contains information about conditions in the past. How did the information get there? When two atoms of hydrogen react with one atom of oxygen to form a water molecule, is that directed by someone?

    May you please say how exactly your god made the earth and everything else? (Seems only fair since you are demanding answers from us and do not accept “I don’t know” as an acceptable answer. The implication is that of “I don’t know” is not an acceptable answer from us, then you must therefore have a better answer… let’s see it.)

    Lastly Biff… where is the evidence that your magical god, who must be far more complex than anything in THIS universe, but managed to exist without a “programer” or a “designer”, actually exists.

    Sooooo many questions…. and not a single answer.
    Why is that Biff-o?

  394. on 02 Apr 2013 at 3:56 pm 394.Fluttershy said …

    ….maybe ask one at a time and insist on answering it?…

  395. on 02 Apr 2013 at 4:07 pm 395.DPK said …

    We’ve been asking one at a time what evidence the have for their imaginary god as long as I have been frequenting here… they never answer that.
    I just wanted to make a spectacle of the fact that none of the Asstrophysicist’s sock puppet persona EVER answer any questions about their claims. All they EVER do is deflect and dodge. That is very telling.

    At least the poor idiot messenger makes an attempt… as clueless as he is, he will at least make an effort to make some shit up, or offer some of his typical circular reasoning, or cut and paste some bullshit. I’ll at least give him that. The other socks, in addition to writing in the exact same style, using the same grammatical errors, and from time to time being caught responding under the wrong moniker, never actually engage in anything but straw man arguments and special pleadings.

  396. on 02 Apr 2013 at 5:43 pm 396.Fluttershy said …

    I did seem to get somewhere (bluntly…) with Biff…
    but you are correct with messenger being an idiot, he doesn’t know left from right ;D
    I wonder where S0lom0n is…

  397. on 02 Apr 2013 at 5:46 pm 397.Fluttershy said …

    Hey DPK, i, as much as you do, want an answer from Biff ;D
    So maybe can we simply ask one question at a time and continue doing so until a logical answer is found? (might take….15? lifetimes but whatever…)

  398. on 02 Apr 2013 at 6:24 pm 398.Biff said …

    Dpk you cannot keep A separate from Biff? Two names are that difficult while I must keep up with 3-4?

    Let me recap. Anon uses starlight as an answer for how DNA was written, DPK doesn’t know and Flutter uses abiogenesis. Those have nothing to do with DNA.

    How can I put faith in natural processes writing DNA code when zero proof exists? We have eliminated God so how could it be possibly done? Could it be possible you are not familiar with high information coding?

  399. on 02 Apr 2013 at 6:33 pm 399.Biff said …

    DPK you very obviously are not familiar with high information coding. You actually compared it to a sand dune.

    OMG, that is so ludicrous and frankly ignorant. Do u even know anything about coding?

  400. on 02 Apr 2013 at 7:09 pm 400.DPK said …

    “How can I put faith in natural processes writing DNA code when zero proof exists?”

    You don’t believe DNA exists? You are a strange one.

    Told you, I haven’t “ruled out” anything… show me this god actually exists and that he wrote this program you are talking about. If the evidence is compelling, I’ll believe it. You haven’t done that.

    On the other hand, DNA exists, chemistry exists, nature exists. There is abundant evidence as to how DNS replicates, and how that replication process can result in changes over time… in other words, evolve.

    Why should I believe some god did it? Why don’t you believe the sea turtle is responsible Biff?
    Why don’t you ever answer any questions, but always demand answers of others? Lastly, why don’t you just show us your god exists, Biff? Why don’t you answer the question about time, Biff? Why don’t you explain who coded your imaginary god, Biff?

    “DPK you very obviously are not familiar with high information coding. You actually compared it to a sand dune.”

    Did I Biff? Where did I “compare it” Biff? You were the one who said there is no evidence that nature “shows absolutely no ability whatsoever to perform such a task.”

    Is time infinite Biff? It must be, because god is infinite, no? You always balk at pinning down any specifics about your god, don’t you Biff?

  401. on 03 Apr 2013 at 12:48 am 401.Biff said …

    “I haven’t “ruled out” anything… show me this god actually exists and that he wrote this program you are talking about. If the evidence is compelling, I’ll believe it. You haven’t done that.”

    I haven’t ruled anything out either or mentioned God. Show how nature can write high information code and I will believe. You haven’t done that.

    “DNA exists, chemistry exists, nature exists. There is abundant evidence as to how DNS replicates, and how that replication process can result in changes over time… in other words, evolve.”

    You show you really DO believe nature wrote the code. Tell me, how do you think DNA evolved?

  402. on 03 Apr 2013 at 1:53 am 402.Anonymous said …

    Honestly, Biffy. A god-of-the-gaps argument is the best that you’ve got? Do you bother to think or does the bullshit just flow every time you open your gob or jot down your thoughts?

    Where does that nasty evolution idea fit into your model? After all, what happened after (nature/god/sea turtle) created the first cell? Are you a “fixed species” advocate?

  403. on 03 Apr 2013 at 3:03 am 403.The messenger said …

    402.Anonymous, the animals that were on the ark evolved into the hundreds of species that are on the earth.

    Why do you fail to understand this.

  404. on 03 Apr 2013 at 3:41 am 404.DPK said …

    “You show you really DO believe nature wrote the code. Tell me, how do you think DNA evolved?”

    Nature exists. I see no evidence a supernatural agent exists. Why would any rational person conclude a supernatural cause when there is no evidence such a thing IS.

    This I is the same reason you reject the sea turtle.

    Now I am done answering your questions until you answer mine.
    Is time infinite? Did god exist before the Big Bang? Was there a “before” the Big Bang?
    Unless you can demonstrate how god had the ability to create something before time why should I believe it?

  405. on 03 Apr 2013 at 5:36 am 405.Fluttershy said …

    the animals that were on the ark evolved into the hundreds of species that are on the earth.
    Why do you fail to understand this.

    That would be because at the time that the bible states the Ark was made in, there was 2 of every animal at the time, and since then, there has been no evolution. That…and the animals would have eaten him alive…

  406. on 03 Apr 2013 at 5:39 am 406.Fluttershy said …

    Tell me, how do you think DNA evolved?

    DNA is not a species, and hence cannot evolve.
    It can however mutate and cause evolution in species.
    As i said earlier, the existence of DNA does not disprove, nor prove God in any way, as abiogenesis and some guy in the sky could both create such a structure.

  407. on 03 Apr 2013 at 5:41 am 407.Fluttershy said …

    Now Biff, i have answered you question, so please may you answer my question to you.

    Please explain how God physically managed to create all of the things that we know of?

  408. on 03 Apr 2013 at 11:39 am 408.Biff said …

    These gentlemen are so hung up on God that they cannot help but talk about God constantly. Again, I am not arguing for God, I want to understand the logic of nature writing complex information systems, namely DNA.

    Again, we have Fluttershy correcting DPK that DNA does not evolve but now mutates, also known as cancer. How does THIS now account for the coding of DNA of which there are many? Just because you see something does not maean it can perform a task. I have a hammer in my garage but I am sure it cannot write complex coding.

    Give me something of substance that will allow me to put my faith in nature’s ability to write high information coding.

  409. on 03 Apr 2013 at 11:41 am 409.Biff said …

    These gentlemen are so hung up on God that they cannot help but talk about God constantly. Again, I am not arguing for God, I want to understand the logic of nature writing complex information systems, namely DNA.

    Again, we have Fluttershy correcting DPK that DNA does not evolve but now mutates, also known as cancer. How does THIS now account for the coding of DNA of which there are many? Just because you see something does not mean it can perform a task. I have a hammer in my garage that I can see but I am sure it cannot write complex coding.

    Give me something of substance that will allow me to put my faith in nature’s ability to write high information coding.

  410. on 03 Apr 2013 at 12:18 pm 410.Anonymous said …

    What is “high information coding”?
    I am not familiar with it and cannot find information. I have written machine code, assembler, and performed other computer programming. However, the programs of my robots never questioned my existence. They just performed their tasks.

    Are you talking about the original DNA that (nature/god/sea turtle) created in the initial single cells of life? Or is “high information coding” what the modern animals have? Would the Neanderthals have had “high information coding”? the dinosaurs and other extinct species too?

  411. on 03 Apr 2013 at 12:29 pm 411.Fluttershy said …

    DNA does not evolve but now mutates, also known as cancer.

    Please, if you ARE going to talk about DNA and the assorted world of biology, at least know what you are talking about.

    Yes, mutations can cause cancer, for example standing in the radiation of the sun, or a phone in your pocket.
    But some simply mutate DNA, likely in the first cell of an organism, which eventually builds up from generation to generation until there is a new species.

    Also, i never corrected DPK, he has never claimed that DNA “evolves” you made that up, DPK merely claimed that god did not make DNA due to the fact that DNA, like all things in nature, in natural and hence can make itself.

  412. on 03 Apr 2013 at 12:34 pm 412.Fluttershy said …

    i reread through his posts and he did claim it evolved…
    Still, no biggy, so what if he simply doesn’t understand biology?
    Doesn’t prove your god so i’m alright with it ;D
    DPK, i would advise some googling, a sensible atheist like yourself like learning, right?

  413. on 03 Apr 2013 at 12:40 pm 413.freddies_dead said …

    Maybe Biff could define exactluy what he means by such phrases as “complex information systems” and “high information coding”. He likes to talk about information theory but he shows very little understanding of the topic.

    He seems to be dancing around the issue, trying desperately to avoid using the words “specified complexity” – Dembski’s pet phrase that he believed was a marker for intelligent design. Of course Dembski never got around to defining his terms either so I won’t be holding my breath while waiting for Biff to do what Dembski couldn’t.

    While Biff’s working out his definitions maybe he can also explain how you can actually infer design when you assume that everything from rocks to stealth bombers are intelligently designed.

    George H. Smith says it nicely in his book Atheism: The Case Against God??

    “Consider the idea that nature itself is the product of design. How could this be demonstrated? Nature, as we have seen, provides the basis of comparison by which we distinguish between designed objects and natural objects. We are able to infer the presence of design only to the extent that the characteristics of an object differ from natural characteristics. Therefore, to claim that nature as a whole was designed is to destroy the basis by which we differentiate between artifacts and natural objects. Evidences of design are those characteristics not found in nature, so it is impossible to produce evidence of design within the context of nature itself. Only if we first step beyond nature, and establish the existence of a supernatural designer, can we conclude that nature is the result of conscious planning. (p. 268)”??

    i.e. the design hypothesis is self defeating – if everything is designed you cannot discern design. You must first prove God and you can’t use design as part of that proof.

  414. on 03 Apr 2013 at 12:51 pm 414.DPK said …

    Evolve: to change over time.
    DNA most definitely evolves. Mutation and replication “errors” are the mechanics of that evolution. Natural selection is the process that favors certain mutations over others.

  415. on 03 Apr 2013 at 1:06 pm 415.DPK said …

    Freddie… Biff has a history of being very evasive and trolling. He never answers questions, never responds to challenges, and flat out refuses to define his god or any of his properties. The best I ever got out of him was a concession that his postulated creator-designer was a “somewhat, clever, kind of powerful being.” He does this so he can keep moving the goalpost. He knows his delusion is indefensible, so he avoids putting himself in a position where he cannot wiggle out of it. He is completely intellectually dishonest. Sound exactly like anyone else you know? Notice that ASS has been curiously absent during biff’s recent round of bullshit?
    That is so he doesn’t get caught forgetting to change his screen name, as he has in the past, and replying under the wrong persona.
    He is a fraud… But it is fun to repeatedly point it out to others reading.
    Biff… In case you didn’t know it, you are a source of amusement for many. You aren’t fooling anyone with your trolling.

  416. on 03 Apr 2013 at 2:12 pm 416.Anonymous said …

    404.DPK, I have shown you proof of GOD.

    Why do you live in denial?

  417. on 03 Apr 2013 at 2:15 pm 417.The messenger said …

    404.DPK, I have shown you proof of GOD.
    Why do you live in denial?

    Comment 416 was mine. I forgot to type in my name for that one.

  418. on 03 Apr 2013 at 2:20 pm 418.The messenger said …

    The Word of GOD

    Romans 5:3-5
    English Standard Version (ESV)
    3 Not only that, but we rejoice in our sufferings, knowing that suffering produces endurance, 4 and endurance produces character, and character produces hope, 5 and hope does not put us to shame, because God’s love has been poured into our hearts through the Holy Spirit who has been given to us.

    The Word of GOD

    12 And he said O Lord God of my master Abraham, I pray thee, send me good speed this day, and shew kindness unto my master Abraham.

    The Word of GOD

    Luke 10:25-37
    King James Version (KJV)
    25 And, behold, a certain lawyer stood up, and tempted him, saying, Master, what shall I do to inherit eternal life?

    26 He said unto him, What is written in the law? how readest thou?

    27 And he answering said, Thou shalt love the Lord thy God with all thy heart, and with all thy soul, and with all thy strength, and with all thy mind; and thy neighbour as thyself.

    28 And he said unto him, Thou hast answered right: this do, and thou shalt live.

    29 But he, willing to justify himself, said unto Jesus, And who is my neighbour?

    30 And Jesus answering said, A certain man went down from Jerusalem to Jericho, and fell among thieves, which stripped him of his raiment, and wounded him, and departed, leaving him half dead.

    31 And by chance there came down a certain priest that way: and when he saw him, he passed by on the other side.

    32 And likewise a Levite, when he was at the place, came and looked on him, and passed by on the other side.

    33 But a certain Samaritan, as he journeyed, came where he was: and when he saw him, he had compassion on him,

    34 And went to him, and bound up his wounds, pouring in oil and wine, and set him on his own beast, and brought him to an inn, and took care of him.

    35 And on the morrow when he departed, he took out two pence, and gave them to the host, and said unto him, Take care of him; and whatsoever thou spendest more, when I come again, I will repay thee.

    36 Which now of these three, thinkest thou, was neighbour unto him that fell among the thieves?

    37 And he said, He that shewed mercy on him. Then said Jesus unto him, Go, and do thou likewise.

  419. on 03 Apr 2013 at 2:50 pm 419.DPK said …

    416.Anonymous said …

    404.DPK, I have shown you proof of GOD.

    Sorry to say, no you haven’t.
    You have a very silly concept of “proof”.

    Plus, you have demonstrated over and over again that you are a liar. Why should anyone believe anything you say? May I remind you that you claim that humans existed on this planet, in pretty much their present form, “several billions” of years ago… smack in the middle of the pre-cambrian period. That alone is “proof” of how completely delusional you are.

  420. on 03 Apr 2013 at 4:06 pm 420.DPK said …

    409.Biff boffed …

    “… DNA does not evolve but now mutates, also known as cancer.”

    For someone who claims an advanced knowledge of information theory, you say some awfully stupid things there Biffer….. but since you brought up the subject…. why did your perfect designer encode DNA to cause cancer? That seems like a dumb design move from an “intelligent agent”. Especially an eternal, supernatural one.

  421. on 03 Apr 2013 at 6:28 pm 421.DPK said …

    “i.e. the design hypothesis is self defeating – if everything is designed you cannot discern design. You must first prove God and you can’t use design as part of that proof.”

    Good point, and I never thought of it exactly that way, but it is very true.

    Also on point of nature “being unable” to encode what Biff calls “high information”… if a human encodes highly complex information… isn’t that ultimately “nature” doing it? I mean humans are part of nature, so what they do (naturally) is also “natural”! haha…
    I mean if beavers build a damn, isn’t that a natural occurrence? Why is the result of a species natural activities considered “not designed” by nature? No distinction really. If a landscape is sculpted by wind and rain, how is that different from a landscape sculpted by an indigenous creature, whether its a human or an ant colony. Both natural occurrences.

  422. on 03 Apr 2013 at 7:03 pm 422.Tom said …

    DNA never has information added only lost. Therefore it could never evolve from simple forms of life to more complex forms as some here seem to claim.

    Even in genetic engineering, DNA always eventually evolves back to it’s original state.

  423. on 03 Apr 2013 at 7:15 pm 423.Biff said …


    You are correct. DPK has no concept of biology. You too have very little. You two can’t stop talking about God long enough to give me some concrete reasons why we should have faith in nature writing DNA. Finish laughing at the theist if you must and see if you can give me something more than faith and mere ability to reflect light.

    Tom thank you for the clarification.

  424. on 03 Apr 2013 at 8:02 pm 424.Anonymous said …

    Tom drops a load and runs, The Biffy takes the load:

    DNA never has information added only lost.

    *jaw drops*
    WTF? The first lifeforms (billions of years ago) had MORE genetic information than the lifeforms today? Holy fuck, the stupid meter has just been pinned!!!

    Or are you talking about Adam and Eve? In which case it makes perfect sense (to a xtian theist).

  425. on 03 Apr 2013 at 8:30 pm 425.The messenger said …

    Brother 419.DPK, I have never lied on this site.

  426. on 03 Apr 2013 at 8:37 pm 426.DPK said …

    “DNA never has information added only lost.”

    Been hanging on the nutjob creationists sites I see…


    Gene duplication with a mutation amounts to an addition of information, so your statement is absurd.


  427. on 03 Apr 2013 at 8:38 pm 427.DPK said …

    And yes Tom… thank you for the clarification.

  428. on 04 Apr 2013 at 2:37 am 428.alex said …

    “…give me some concrete reasons why we should have faith in nature writing DNA”

    the burden of proof is on you, moron. is this whywontnaturehealamputees.com? maybe the GreenHornet wrote the DNA, but i can’t defend it any more proper than you can defend your god, which makes them both equally bullshitty.

    you’re just looking for every fucking atheist utterance so that you can just lock on and try to divert the attention, don’t you? fuck nature, aliens, abiogenesis, spontaneous combustion, and specially your god, but i’m a reasonable. i can be convinced, but not bullshitted.

  429. on 04 Apr 2013 at 3:05 am 429.Tom said …

    Mutations only shuffle the existing DNA of an organism to achieve a different result. Occasionally these might result in a favorable adaptation This is all mutations have been scientifically observed to do. More times than not the mutations are harmful.

    No new information is added. A loss of information results in a variety in species. wolves being breeded to becomes Yorkies is just one example.

  430. on 04 Apr 2013 at 4:00 am 430.s0l0m0n said …

    Fluttershy 396,

    I’am alive & kickin’, ready to thrash the atheists beliefs. I’am at out station doing auditing works.

  431. on 04 Apr 2013 at 9:20 am 431.Anonymous said …


    wolves being breeded to becomes Yorkies is just one example.

    That is not evolution, my friend.

    How old do you think our planet Earth is? And how long have humans been around on this planet?

  432. on 04 Apr 2013 at 11:44 am 432.A said …

    “spontaneous combustion”

    alex did u mean spontaneous generation or are you referring to human beings suddenly igniting?


    You need to stop showing your ignorance while you are ahead. Microevolution is the only type of evolution of which proof exists.

    Go back to your desk and listen to your teacher.

  433. on 04 Apr 2013 at 1:02 pm 433.Anonymous said …

    Welcome back, “A”.

    Since you seem to be on the same page as Biffy and Tom about his idea of “high information coding”, maybe you can help flesh out some of the details for us. Like, for instance, what is it?

    So far, we seem to have discovered that:

    DNA never has information added only lost. Therefore it could never evolve from simple forms of life to more complex forms as some here seem to claim.

    As a learned Astrophysicist, maybe you should delicately ask Biffy and Tom how old they think the Earth is. Try not to be overly rough (as only you can be) on their sensitive natures – ignorance is not something to be proud of. We both know our wonderful planet Earth is billions of years old and the original lifeforms were of the simple single celled varieties.

    Politely ask Biffy and Tom to stay awake and

    Go back to your desk and listen to your teacher

  434. on 04 Apr 2013 at 1:36 pm 434.freddies_dead said …

    429.Tom said …

    Mutations only shuffle the existing DNA of an organism to achieve a different result.

    You have absolutely no idea how DNA mutation works do you? Mutations can be from unrepaired damage, errors in replication or the insertion (you might want to make a note of that one) or deletion of DNA segments not to mention recombination through procreation of sexual species and gene transfer in bacteria.

    Occasionally these might result in a favorable adaptation. This is all mutations have been scientifically observed to do. More times than not the mutations are harmful.

    Thank you for conceding that mutation has been scientifically observed. Now all we need is a selective pressure to work on the populations undergoing gene mutation and those that have the beneficial mutations will be more fit for their ecological niche and will, therefore, be more likely to survive and procreate, so passing on those beneficial mutations to subsequent generations. Allele frequency in the population changes as the beneficial mutation proliferates and, w00t! we’ve got evolution. None of this macro/micro evolution shit either – evolution is the simply the change in allele frequency in populations. Anyone who wants to claim distinct types of evolution needs to explain exactly how they distinguish between the types by defining exactly what barrier they think there is to stop one type becoming another.

    No new information is added.

    This is just plain wrong. Take an example of a DNA segement that runs ctccggggcc but a replication error duplicates the sequence ctccggggccctccggggcc while another mutation changes the duplicated sequence to ctccggggccctaaggggcc. Now, not only do we have double the amount of information, it’s also not just the same information twice, it’s actually the original segment plus an entirely new one. New information.

    A loss of information results in a variety in species.

    It’s the change in information that results in the diversity. That change may be the addition of new information, a loss of information or simply a change in the information.

    wolves being breeded to becomes Yorkies is just one example.

    An example of selective breeding whereby humans pick certain traits and then deliberately breed for them. Contrary to Anonymous’ comment at 431 it’s still technically evolution at work – it is a change in allele frequencies in a population over time after all. However, it is forced by humans who are trying to ensure certain traits are kept whilst others are bred out. We become an artificial selective pressure – we decide what “fitness” is and we control the population’s ability to procreate – and therefore passing on the “beneficial” genes – in this context. We are also only making these decisions based entirely on outward appearance, whether the DNA changes are internally beneficial isn’t taken into consideration.

  435. on 04 Apr 2013 at 1:39 pm 435.freddies_dead said …

    432.A said … (to Anonymous)

    Microevolution is the only type of evolution of which proof exists.

    Please explain exactly how you distinguish between the types of evolution that you think there are and then explain what barrier you think exists which prevents one type of evolutionary event from happening?

  436. on 04 Apr 2013 at 2:08 pm 436.Anonymous said …

    #434 freddies_dead
    You are correct about my definition of evolution. I was thinking of “eugenics”- which is the human equivalent of selective breeding. My definition of evolution is that nature is in control of favouring the desirable/beneficial traits.

    Selective breeding of dogs and eugenics are techniques of artificially selecting species for desirable traits. This would lead to shifts in the DNA coding which can be defined as evolution.

    Now that that is clear, how about Biffy and Tom expanding their thoughts on the idea of “high information coding”.

  437. on 04 Apr 2013 at 2:34 pm 437.DPK said …

    “432.A said … (to Anonymous)

    Microevolution is the only type of evolution of which proof exists.”

    Seriously guys, this is the type of utter nonsense that is not even worthy of being dignified by a response other than laughter.

    No wonder the rest of the civilized world thinks the US is a land populated by imbeciles.

  438. on 04 Apr 2013 at 2:53 pm 438.DPK said …

    Still waiting for Biff (who has now disappeared and returned as ASS) to answer why his intelligent designer programed DNA to cause cancer…. or actually any of the many questions he has been asked for which no response has been offered.

    Could it be he is just trolling!!!? Gasp!

    Tom… messenger said that all the species in the world today evolved from a limited number of animals Noah put on the ARK about 2 or 3 BILLION years ago.

    Is he wrong about that?

    You Christards need to get your stories straight… you can’t all be right, but interestingly, you CAN all be wrong. hahahaha

  439. on 04 Apr 2013 at 5:31 pm 439.The messenger said …

    437.DPK, elvolution does not effect humans.

  440. on 04 Apr 2013 at 5:34 pm 440.The messenger said …

    438.DPK, only animals evolve.

    Humans have never evolved, humans are the same as they have always been.

  441. on 04 Apr 2013 at 5:36 pm 441.The messenger said …

    on 29 Mar 2013 at 10:39 pm 318.The messenger said …
    I have heard some people say that GOD did not cause the Black Plague in Europe.
    I disagree. I believe that GOD manipulated those infected fleas to latch on to those rats and guided them to the Italian boats so that Europe would be cleansed of all the despicable people there.

  442. on 04 Apr 2013 at 11:58 pm 442.Biff said …

    “Contrary to Anonymous’ comment at 431 it’s still technically evolution at work”

    Yes, Anony has no clue what he is talking about any more than DPK or alex. They just repeat what they have heard and somehow believe they are stating facts.

    Ok Never Steady Freedie claims a subset of the already existing DNA in that organism is actually adding to the existing DNA although all it has done is shuffle what existed. Whatever you would like to call the process, the variation, cannot become immense if all it does is reorganize the existing DNA, it is severely limited to the existing code.

    Nevertheless, that was not the question.

    Now, is anyone going to provide one solid reason why we should believe nature wrote DNA code? We need more than nature exists, DNA exists and we should therefore believe.

  443. on 05 Apr 2013 at 12:52 am 443.Anonymous said …

    Anony has no clue what he is talking

    You’re absolutely correct.

    Please fill in some of the blanks and educumate me. What is “high info coding”? I need your special guidance. I need someone who knows to show me the way.

    is anyone going to provide one solid reason why we should believe nature wrote DNA code?

    First life simple single cells. Fast forward to today – complex life, multi-cellular. Does that meet your criteria for something? Anything? You’re one tough customer, but only when it comes to reality. You’ll swallow, hook line and sinker, anything about jewish zombies, your special god, miracles, etc, etc.

    Need more details on your idea. Flesh it out. Tom’s comment about DNA continual degrading gave you a hard on so I assume you like the Adam and Eve story. Yes? You are such a fountain of knowledge, don’t keep it contained. Spew it out, dammit!!

  444. on 05 Apr 2013 at 12:59 am 444.s0l0m0n said …

    “need to get your stories straight… you can’t all be right, but interestingly, you CAN all be wrong. hahahaha”

    But the true religion can’t be wrong at all.


  445. on 05 Apr 2013 at 1:12 am 445.s0l0m0n said …

    “is anyone going to provide one solid reason why we should believe nature wrote DNA code?”

    Nature is just a created “word”. It can do nothing.A ‘being’ example a bird, can do something. So all creations or process must be done by a being. The most powerful & intelligent being is GOD.

  446. on 05 Apr 2013 at 1:56 am 446.DPK said …

    Is a hurricane a being?

  447. on 05 Apr 2013 at 2:37 am 447.The messenger said …

    DPK, GOD manipulates the elements on earth, thus creating a hurricane.

  448. on 05 Apr 2013 at 11:38 am 448.Biff said …

    “First life simple single cells. Fast forward to today – complex life, multi-cellular. Does that meet your criteria for something?”

    Only your continued ignorance unrealized or maybe realized. After you have had your basic high school biology class and passed it, feel free to try again. I will acknowledge the incredible faith you have in nature.

  449. on 05 Apr 2013 at 12:01 pm 449.Anonymous said …


    “First life simple single cells. Fast forward to today – complex life, multi-cellular. Does that meet your criteria for something?”
    Only your continued ignorance unrealized or maybe realized.

    I guess I gotta pick up a bible for the real story.

    Allow me to summarize poor old Biffy’s belief:
    1.) I don’t know how life began
    2.) Evolution sucks
    3.) High info coding.
    4.) Life always goes from more complex to less complex
    5.) The Earth is 10,000 years old
    6.) Adam and Eve and Noah’s Ark are non-fictional accounts
    7.) Nature can’t so goddidit
    8.) I don’t have a fucking clue what I am talking about

    Looked in the Biffy, saw a turd. Time to flush.

  450. on 05 Apr 2013 at 12:47 pm 450.The messenger said …

    449.Anonymous, if you are just going to insult him rather that provide a relevant argument, I suggest that you leave.

  451. on 05 Apr 2013 at 3:03 pm 451.DPK said …

    “is anyone going to provide one solid reason why we should believe nature wrote DNA code?”

    uh… look in the mirror?

    For those you claim that there is no evidence for speciation, often incorrectly refereed to as macroevolution:

    For those that claim that information is never added to DNA, but only lost:

    Now, can we put the diversions away? Even if evolution was somehow tomorrow proven to be 100% wrong… how does that prove the existence of your imaginary god?

    Why won’t ANY of you have the balls to just admit that you have absolutely no good reason to believe that your supernatural god actually exists, and that you believe it simply because you WANT to?
    There is no shame in that. Why don’t you just admit it instead of continually embarrassing yourself by pretending to know things you do not know, and by lying and misrepresenting scientific facts in order to make your delusion seem somewhat less insane?
    Believe me, no one here will think any less of you for admitting the truth. It may well be your first step to recovery from your mental illness that causes you to believe in invisible friends.

  452. on 05 Apr 2013 at 3:14 pm 452.A said …


    Mouse is attempting to tutor you. Cells make up DNA. Yes, you heard ot here first. The cellular program was written by no other than Steve Jobs.
    Thanks for coming and special thanks to the mouse.

  453. on 05 Apr 2013 at 3:40 pm 453.Anonymous said …

    For “A”, the astrophysicist?

    Instead of being afraid of shitting on the Biffy, why don’t impress the audience and inform us with your scholarly knowledge.
    What is the age of the planet Earth and when did first life arise?
    Too afraid to answer a few simple questions, methinks. Put your advanced education to work.

  454. on 05 Apr 2013 at 4:29 pm 454.DPK said …

    Have you know respect for “A” academic accomplishments?

    He is not just an astrophysicist, as he has told us he is an UPPER CASE “Astrophysicist”! How dare you question his unsupported claims?

    Stay thirsty, my friends….

  455. on 05 Apr 2013 at 5:13 pm 455.Anonymous said …

    “A”, the esteemed “A”strophysicist:

    Mouse is attempting to tutor you.

    Tutor? Don’t think so. Maybe challenge and ask for some clarity, which we both know will not be happening. You also know how the theist game is played. ;-).
    Duck, dodge, weave, wiggle, run.

  456. on 05 Apr 2013 at 7:20 pm 456.Biff said …

    If A Nony is tutoring in no answers and diversions rather than Answering a question well then, well done sir!!

    It should be so easy. If no God exists then showing links of nature writing code should be easy.

    The latest response is look in a mirror. Lets try that in a fictional situation.

    Prove my hammer wrote DNA code?

    Answer: Look in the mirror.

    Hmm, that answer fits any possibility

  457. on 05 Apr 2013 at 7:59 pm 457.Anonymous said …

    As predicted. No age of the Earth. No time frame.

    I would hate to have a serious debate with a group of Young Earthers because it’s a waste of time. I DO UNDERSTAND that in your world life arose differently than in what has been observed and proven to be fact (aka REALITY). But cling, if you must, to Adam/Eve + Noah. No harm – just no room for discussion. Likewise, I don’t debate with people on how many angels can fit on the head of a pin.

    “A” and the Biffy get a “F”, as in failure when it comes to providing any meat to the discussion in this thread. All sizzle, no steak or, more appropriately, a Biffy without a flush lever, somewhat useful but inevitably in need of repair.

  458. on 05 Apr 2013 at 8:55 pm 458.DPK said …

    “Prove my hammer wrote DNA code?

    Answer: Look in the mirror.

    Hmm, that answer fits any possibility”

    Well, admittedly, the hammer make more sense than your imaginary god. At least we know hammers exist.

    You really equate the fundamental laws of nature which govern matter and energy equivalent to a hammer?

    Ok… well that explains why you believe in invisible, magical beings. You need to go watch for snakes sprouting wings. Lemme guess.. you were home schooled, right?

  459. on 08 Apr 2013 at 4:58 am 459.s0l0m0n said …


    “Is a hurricane a being?”

    At first glance it is just air particles being directed by God to go anywhere. But the essence of it, it possess souls just like other beings. Just like our earth, rotating round the sun, all directed by God and gladly abide by the earth.

    If you doubt it or might have some other explanation like the centrifugal force of the sun controls the earth rotation, think again.Which one comes first? Is it the centrifugal force of the sun makes the earth change direction rather then going into a straight line or is it the earth itself willingly changes direction as ordered by god?

    Don’t try to explain that hurricanes arise due to high or low pressures. That is the outdated version.

  460. on 08 Apr 2013 at 3:02 pm 460.DPK said …

    Ta Da!!

    And just when you thought he couldn’t POSSIBLY be any more insane, Solomon cranks the crazy dial up to 11!

    Now, a hurricane is a “being” with a “soul”.. directed by god. So, does a hurricane go to heaven? It has a soul, after all?

    And, I assume it is then against god’s will to rebuild something after it was destroyed by a hurricane, tornado, or other natural disaster? Stop sending money to the Red Cross for disaster relief everyone… god wants those people to suffer.

    How many thousands were killed in that Tsunami a few years back? According to messenger and Solomon, god wanted them dead… he directed the water to kill them, and therefore, they all must have been evil, because god only kills evil people.

  461. on 09 Apr 2013 at 12:41 am 461.s0l0m0n said …

    ” According to messenger and Solomon, god wanted them dead…”

    I didn’t imply that.

  462. on 09 Apr 2013 at 1:28 am 462.alex said …

    461.s0l0m0n said …
    ” According to messenger and Solomon, god wanted them dead…”
    I didn’t imply that.
    459.s0l0m0n said …
    “Is a hurricane a being?”
    At first glance it is just air particles being directed by God to go anywhere. But the essence of it, it possess souls just like other beings. Just like our earth, rotating round the sun, all directed by God and gladly abide by the earth.
    you lyin biatch, go baaaaack to fucking your sheep. what? dpk is talking about the tsunami and not about the hurricane? same shit, asshole. hurricanes kill people because god wanted them dead.

  463. on 10 Apr 2013 at 3:21 pm 463.s0l0m0n said …

    “hurricanes kill people because god wanted them dead.”
    I still didn’t imply that.
    alex is a fuckin’ ass.

  464. on 10 Apr 2013 at 3:26 pm 464.s0l0m0n said …

    Points to ponder..

    If God could grant a soul to human, granting a soul to the earth for example should be much simpler.

  465. on 13 Apr 2013 at 12:43 pm 465.Fluttershy said …

    souls don’t exist.

    Soles do however, are you mistaking the two words?

    Why do so many people insult alex?

  466. on 13 Apr 2013 at 2:01 pm 466.Anonymous said …

    “Why do so many people insult alex?”

    Because it gives them something else to argue about instead of producing the evidence that they are not mentally ill.

  467. on 13 Apr 2013 at 4:17 pm 467.Fluttershy said …

    Good point ;D

  468. on 14 Apr 2013 at 5:56 am 468.s0l0m0n said …

    Atheists go at lengthy to sway people from the true path, but could not refute even a single piece of God’s mere words.

  469. on 14 Apr 2013 at 1:30 pm 469.alex said …

    go baaack to your sheep, s0l. they miss you.

  470. on 14 Apr 2013 at 6:32 pm 470.The messenger said …


    You insult us all the time, as a way to cover up your arrogance.

  471. on 15 Apr 2013 at 1:14 am 471.s0l0m0n said …

    alex’s soul originates from ((((HELL)))), being granted a few days spree on earth, will go back to ((((HELL)))) soon.

  472. on 15 Apr 2013 at 4:48 pm 472.Fluttershy said …

    Ohh s0l0m0n and your hell….

    …What exactly is hell like?
    Is there any good fishing spots?
    ooh, ooh, what about a sun tanning booth?, i could do with one of those.

  473. on 15 Apr 2013 at 5:36 pm 473.DPK said …

    If heaven is going to be filled with assholes like Solomon… sign me up for {{{HELL}}}!

    Hey Messy… Alex and I may be going… but remember, old Sol says YOU will be first in line!!!
    yuk, yuk, yuk…..

  474. on 16 Apr 2013 at 1:55 am 474.Anonymous said …

    Messy, the question was about Alex.

    What is wrong with you that you need to make every post about your persecution complex and your insecurity?

  475. on 16 Apr 2013 at 7:20 am 475.s0l0m0n said …


    I would recommend you the body barbeque booth.

  476. on 16 Apr 2013 at 10:44 am 476.Fluttershy said …

    Is that like when they cover you in bacon first?
    That sounds good :D

  477. on 17 Apr 2013 at 12:43 am 477.s0l0m0n said …


    I think that’s about it. A blazing flaming bacon coat from ((((HELL)))).

  478. on 29 Apr 2013 at 8:13 am 478.Sean said …

    God managed to place both proof of his existence, and proof of Jesus Christ’s existence within the Bible, and did so in such a clever encoded manner.

    To see True Bible Codes, go to http://www.outersecrets.com/real/biblecode2a.htm

    Click on the flashing words “Watch / Listen”, and let the webpage take you on a webpage tour of such proof.

    But don’t forget today’s trend… “Reject before Inspect.”.

  479. on 29 Apr 2013 at 12:07 pm 479.alex said …

    “But don’t forget today’s trend… “Reject before Inspect.”.”

    don’t forget the xtian trend. the bible is everything, cept for the ones not to be taken literally. of course, every xtian is “THE” personal translator. everybody else is not a real xtian. what morons.

  480. on 29 Apr 2013 at 2:02 pm 480.Fluttershy said …

    I think that’s about it. A blazing flaming bacon coat from ((((HELL)))).

    nice, do they come in small?
    Im not the biggest guy in the world :D

  481. on 29 Apr 2013 at 2:15 pm 481.Fluttershy said …

    i also ponder why no one spells my name correctly

Trackback This Post | Subscribe to the comments through RSS Feed

Leave a Reply